OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR122 Human MicroRNA Expression Plasmid (MI0000442)

Be the first to review this product
SKU
SC400047
Expression plasmid for human microRNA MIR122
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR122 or MI0000442"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGCUAGGC:
Mature Sequence: UGGAGUGUGACAAUGGUGUUUG:
Full Insert
>MI0000442 GCAAACAGAGTTCCTGTCCATTTTCACAGGAAGTTTTTGCAGAAGGGGTTTGCTGGGTGGCAGTGGAACACAGGCAGTGGACCCCTCTACTACTCTACTGTTCCAGAACACAGAAGCCTTTCATTGAGAGTGTTCAGCTCTTCCCATTGCTCAAGATGCTTGTACCCGTGATGCTTCTTTTCTCTGCTTAGGTCACAATATGTGGAGCTGACAAGGTTCCCCTATTATCAGTGACAATGGTGGAATGTGGAGGTGAAGTTAACACCTTCGTGGCTACAGAGTTTCCTTAGCAGAGCTGTGGAGTGTGACAATGGTGTTTGTGTCTAAACTATCAAACGCCATTATCACACTAAATAGCTACTGCTAGGCAATCCTTCCCTCGATAAATGTCTTGGCATCGTTTGCTTTGAGCAAGAAGGTTCATCTGATATCAGTCTTCTCAATCTTGTGTACTTACTGAATAAAGTCTGGTTCTTTTGCACTCATAACCAATATGGTTAGCTGAACCCTGCCTCTCACATGCTGTTGTTACATACCTTAGCTGGTGATTAATTTTCTTGTTTTCCCAAGTCAATAAAAAGATTGCAGACCAGGCACGGTGGCTCACGCCTGAAATCCCAGCACTTTGGGAGGCCAAGGCAGGCGGATCACTTGAGCT
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000442
Synonyms MIR122A MIRN122 MIRN122A miRNA122 miRNA122A hsa-mir-122
Locus ID 406906
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Association of MiRNA122 & ADAM17 with Lipids among Hypertensives in Nigeria
Meka, Anyim, Enebe et al
Open Med (Wars) (2018) 13, 350-358 DOI: 10.1515/med-2018-0053
AI Summary: OriGene Technologies contributed to this study by providing lyophilized qPCR miRNA-122 template standards, which were used to quantify miRNA-122 levels in the participants.
Snippet: uanidine isothiocyanate–phenol: chloroform extraction method [18] and quantified with quantitative polymerase chain reaction (qPCR). Lyophilized qPCR miRNA-122 template standards were obtained from Origene Technologies, Rockville, USA. 2.4 Inclusion criteria Consenting adult hypertensive patients without any history of previous cardiovascular event were recruited for the study. 2.5 Exclusion c
FigureFigureFigure
Permissiveness of human hepatocellular carcinoma cell lines for hepatitis C virus entry and replication
Coto-Llerena, Koutsoudakis, Boix et al
Virus Res. (2017)
AI Summary: In this study, the pCMV-miR122 plasmid from OriGene was used to exogenously express miR122 in BCLC-5 cells, enabling researchers to assess its effect on hepatitis C virus RNA replication and cell permissiveness.
Snippet: …The pCMV-miR122 plasmid containing the MIR122 precursor sequence was purchased from OriGene Technologies, Inc (Rockville, MD, USA). 2.5. …The pCMV-miR122 plasmid containing the MIR122 precursor sequence was purchased from OriGene Technologies, Inc (Rockville, MD, USA). 2.5. …
Restoring miR122 in human stem-like hepatocarcinoma cells, prompts tumor dormancy through Smad-independent TGF-β pathway
Boix, López-Oliva, Rhodes et al
Oncotarget (2016) 7 (44), 71309-71329 DOI: 10.18632/oncotarget.11885
Snippet: BCLC9-miR122 cells were obtained by electroporation of pCMV6-GFP-MIR122 plasmid (MI0000442, OriGene Technologies. Rockville, MD). BCLC9-AKT3 KD stable cell line was obtained by lentiviral infection of pGFP-C-shAKT3 (TL320629, OriGene Technologies. Rockville, MD)
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products