OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR1-1 Human MicroRNA Expression Plasmid (MI0000651)

Be the first to review this product
SKU
SC400026
Expression plasmid for human microRNA MIR1-1
  $424.00
4 Weeks*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR1-1 or MI0000651"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCA:
Mature Sequence: UGGAAUGUAAAGAAGUAUGUAU:
Full Insert
>MI0000651 TGCCTTTCTGGATCGTGTGAGTGTGTGAGACAGACAGAGAGAGATGGATTCAGGGATGGAGGGGCGCCGA
GGTCAGAAGGGGGCAGGGAGTCCTGGGCCCCTGGGGGTGGCTGGACACCAGGCAGCAGTGGCAGGAAGGC
TGTCCTGCTCACACAGAGAGGGCTCCGGCAGTAGACTCCAGGGAAGAAGTTACACTGCCTCTGAGCTGCC
TTCTCTACATCGCAGTGGGGTCAGCTTCTACCGGGGCGGCGTCCCGGGGTCTTGGAACTGCATGCAGACT
GCCTGCTTGGGAAACATACTTCTTTATATGCCCATATGGACCTGCTAAGCTATGGAATGTAAAGAAGTAT
GTATCTCAGGCCGGGACCTCTCTCGCCGCACTGAGGGGCACTCCACACCACGGGGGCCGCCGCGGCCGAC
AGCCAGCCAGGCGGCTGTGGTGGGGGTGAGGCTGGGGCGGCAGGCTGCCTGGGCGTTGGTGGACGGTCGT
GTCCCCGCCAGCATTGTTCTGTCACTTTGCCTGTGTCAGCAGGTGGAAGTGCTCACCAGACATTAAATAT
TCAGCTTGCTGACTGCGGCAGAGGGGAGGCGGCCTCCGGCAGGCGCGGGGTCCAGCGCGGGGCTGGTGAG
GGCTGGGGGGTCG
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000651
Synonyms MIRN1-1 miRNA1-1 hsa-mir-1-1
Locus ID 406904
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Androgens regulate CALCA gene expression in the prostate by methylation of CALCA Promoter
Masud, Chaudhary, Shah
Research Square (2022)
Snippet: We knocked out AR expression in LNCaP and VCaP cell lines by CRISPR/cas9 system (sc400026, Santacruz Biotechnology, Dallas, TX). We enforced the expression of AR in PC3 cells using constitutively active AR expression vector (pCMV6, Origene Technologies, Inc Rockwell, MD). Both AR modulations were verified for AR by Western blot analysis in respective cell lysates
miR-375- and miR-1-Regulated Coxsackievirus B3 Has No Pancreas and Heart Toxicity But Strong Antitumor Efficiency in Colorectal Carcinomas
Hazini, Dieringer, Pryshliak et al
Hum Gene Ther (2021)
Cited by 28
AI Summary: OriGene products pCMV-miR-1, pCMV-miR-375, and pCMV-miR (GFP control) expression plasmids were used to transiently express specific microRNAs in HEK293T cells, enabling the authors to assess the microRNA-dependent attenuation of engineered Coxsackievirus B3 variants.
Snippet: percent confluent HEK293T cells were transfected with 800 ng miR expression plasmids;pCMV-miR-1 expressing the miR-1, pCMV-miR-375 expressing the miR-375, and pCMV-miR expressing only green fluorescent protein (GFP) as control (Origene Technologies;- percent confluent HEK293T cells were transfected with 800 ng miR expression plasmids
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products