OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR101-1 Human MicroRNA Expression Plasmid (MI0000103)

Be the first to review this product
SKU
SC400013
Expression plasmid for human microRNA MIR101-1
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR101-1 or MI0000103"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: UGCCCUGGCUCAGUUAUCACAGUGCUGAUGCUGUCUAUUCUAAAGGUACAGUACUGUGAUAACUGAAGGAUGGCA:
Mature Sequence: CAGUUAUCACAGUGCUGAUGCU:
Full Insert
>MI0000103 TGCTGGAAGCTTACTGCATATTTGATGTATTAGAGTGAAAACCTAATCATGCAGTTGTTCATCCTCATTA
ATATGGATAAGTCATGTGTTCATCTTTCATTCTAATTTAATTCAACTGGGCCTTTTAATATTTCAGCCTC
ACCACTTGCTGGGCTCTGATCCTTCTTTTTCTTCTGCCTCCTCACGTCTCCAACCAGAAGGTGATCTTTT
AGTCCTTCACTTCATGGGGAGCCTTCAGAGAGAGTAATGCAGCCACCAGAAAGGATGCCGTTGACCGACA
CAGTGACTGACAGGCTGCCCTGGCTCAGTTATCACAGTGCTGATGCTGTCTATTCTAAAGGTACAGTACT
GTGATAACTGAAGGATGGCAGCCATCTTACCTTCCATCAGAGGAGCCTCACCGTACCCAGGAAGAAAGAA
GGTGAAAGAGGAATGTGAAACAGGTGGCTGGGACCCAGAAACCCTCTTACCCTGCACCTCTGTCATACTT
CTCCCGGGGCATAGGGAGAGTTATTCTGCTTCTCTTTGCCTTGTTTTGTAACATGGGGTAGTTGTTGGTG
CAGCCATGTTGTGCTGAGTGAACATATATTAAGATCTTTGGAACCTTTAGGAGACTGAAAATAGGTAAGT
ATGAATTAGTATTTCTGGAATGGTATTCAGAGAACTTCG
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000103
Synonyms MIRN101-1
Locus ID 406893
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

MiR-101 Targets the EZH2/Wnt/β-Catenin the Pathway to Promote the Osteogenic Differentiation of Human Bone Marrow-Derived Mesenchymal Stem Cells
Wang, Meng, Cui et al
Sci Rep (2016) 6, 36988 DOI: 10.1038/srep36988
AI Summary: OriGene contributed to this study by providing the miR-101, anti-miR-101, and EZH2 siRNA products used for transfection experiments to investigate the molecular mechanisms underlying osteogenic differentiation in human bone marrow-derived mesenchymal stem cells.
Snippet: nm. The results were normalized to the total cellular protein content. Lentivirusinfection and oligonucleotide transfection. The miR-101, anti-miR-101 and EZH2 siRNAwere purchased from Origene (Beijing, China). The constructs ... Cite SaveSaving
FigureFigureFigure
Dysregulation of miRNAs-COUP-TFII-FOXM1-CENPF axis contributes to the metastasis of prostate cancer
Lin, Kao, Lee et al
Nat Commun (2016) 7, 11418 DOI: 10.1038/ncomms11418
Cited by 125
AI Summary: OriGene Technologies' miRNA expression vectors were used to generate inducible constructs for miR-101, miR-27a, and COUP-TFII, enabling the study of their roles in prostate cancer metastasis and drug resistance.
Snippet: To set up inducible miR-101, miR-27a and COUP-TFII constructs, miRNA expression vectors were purchased (Origene Technologies, Inc) and construction of a COUP-TFII expression vector was described previously13
HIV-1 Tat C modulates expression of miRNA-101 to suppress VE-cadherin in human brain microvascular endothelial cells
Mishra, Singh
J. Neurosci. (2013) 33 (14), 5992-6000 DOI: 10.1523/JNEUROSCI.4796-12.2013
AI Summary: In this study, the OriGene pCMV-Mir miR-101 construct (#SC400013) was used to overexpress miR-101 in human brain microvascular endothelial cells, enabling the authors to investigate how miR-101 regulates VE-cadherin expression and contributes to blood-brain barrier disruption by HIV-1 Tat C.
Snippet: The CDH5 3′UTR construct in pMirTarget (#HmiT000052-MT01;GeneCopeia) and miR-101 construct as pCMV-Mir (#SC400013;Origene) were used in ... A 3.0 μm pore PTFE membrane insert (12-well plate;#3494;Corning Life Sciences) was used in the permeability assays.
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products