tdTomato Escherichia coli Recombinant Protein
SKU
TP790045
Purified fluorescent protein tdTomato, with N-terminal HIS tag, expressed in E. coli, 250ug
$160.00
5 Days*
Specifications
| Product Data | |
| Species | Escherichia coli |
|---|---|
| Expression Host | E. coli |
| Expression cDNA Clone or AA Sequence | |
| Tag | N-His |
| Predicted MW | 54.2 kDa |
| Concentration | >0.05 µg/µL as determined by microplate BCA method |
| Purity | > 80% as determined by SDS-PAGE and Coomassie blue staining |
| Buffer | PBS, pH 7.4, 10% glycerol |
| Note | For testing in cell culture applications, please filter before use. Note that you may experience some loss of protein during the filtration process. |
| Storage | Store at -80°C. |
| Stability | Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. |
| Shipping | Dry Ice |
| Reference Data | |
| RefSeq | AHN10092 |
Reviews
Documents
| FAQs |
| SDS |
Resources
| Recombinant Protein Resources |
Citations
Long-read sequencing quantifies synthetic mRNA abundance, integrity and host response in vivo
McLeod, Yuen, Chen et al
bioRxiv (2026)
McLeod, Yuen, Chen et al
bioRxiv (2026)
AI Summary: OriGene’s tdTomato protein (Cat# TP790045) was used as a spike-in control in tissue samples to generate standard curves for quantifying synthetic mRNA and protein abundance in the study.
Snippet: Blank tissue samples from C57BL/6J mice were weighed and spiked with known amount of Cre recombinase (New England Biolabs;Cat# M0298) and tdTomato protein (Origene;Cat#TP790045) prior to sonication and were used to provide standard curves. For Cre recombinase ELISA, Nunc-Immuno MicroWell
Lineage tracing reveals photoreceptor precursor cell subpopulations that contribute to murine retinogenesis
Yano, Wei, Gajjar et al
Front Cell Dev Biol (2026) 14, 1814134 DOI: 10.3389/fcell.2026.1814134
Yano, Wei, Gajjar et al
Front Cell Dev Biol (2026) 14, 1814134 DOI: 10.3389/fcell.2026.1814134
AI Summary: OriGene’s His-tagged recombinant tdTomato protein (TP790045) was used to prepare compensation beads for flow cytometry analysis, aiding in the accurate identification of photoreceptor precursor cell subpopulations in the study.
Snippet: with each antibody. tdTomato compensation beads were prepared by conjugating beads with anti-His antibody (1:500, AB_914704, GenScript) and His-tagged recombinant tdTomato protein (1 μg, TP790045, OriGene). GFP BrightComp eBeads Compensation Bead (A10514, Invitrogen) were also used for the Dll1-Cre;Ai9 sample analysis to account for the EGFP reporter. Samples were
The Role of Matrix Viscoelasticity as a Biophysical Cue in Macrophage Phenotype Regulation in the Early Fracture Hematoma
Knecht
DepositOnce (2026)
Knecht
DepositOnce (2026)
AI Summary: OriGene’s tdTomato protein (#TP790045-OR) was used to incubate alginate hydrogels, enabling fluorescent labeling for visualization and analysis of the engineered extracellular matrix in macrophage phenotype studies.
Snippet: Bone fracture healing begins with the formation of a hematoma, a dynamic injury niche characterized by complex, intertwined inflammatory processes that set the trajectory;Alginate hydrogels were incubated in either 60 μg/mL green fluorescent protein (GFP) (Merck Millipore, #14-392) or 30 μg/mL tdTomato (OriGene, #TP790045-OR) in a 96-well plate for 24 hours at room temperature under light-protected conditions
Development of a high-yield Rabbit line for enhanced animal pharming
Song, Yang, Kong et al
Biol Res (2025) 58 (1), 73 DOI: 10.1186/s40659-025-00653-y
Song, Yang, Kong et al
Biol Res (2025) 58 (1), 73 DOI: 10.1186/s40659-025-00653-y
AI Summary: OriGene’s recombinant tdTomato protein (TP790045) was used to generate a standard curve for accurately quantifying tdTomato expression levels in rabbit milk in this study.
Snippet: 1/R1 are shown below: L1: 5′- TGGGCCCAGGAGATGACAGTTTT -3′ R1: 5′- GCCGGGTAGAGCTTTGGGTTTTT -3′ Determination of the concentrations of tdTomato in Rabbit milk Recombinant tdTomato (TP790045, Origene, Rockville, MD, USA) was utilized to create a standard curve. Briefly, the recombinant tdTomato was serially diluted to concentrations of 0 (no tdTomato), 0.135, 0.108, 0.054, 0.027, and 0.013
Photobleaching Analysis of Fluorescent Proteins in Two-Photon Microscopy at High Repetition Rates
Weng, Han
Optics Communications (2024)
Weng, Han
Optics Communications (2024)
Cited by 3
MicroRNA-7a2 regulates prolactin in developing lactotrophs and prolactinoma cells
LaPierre, Godbersen, Esteban et al
Endocrinology (2020)
LaPierre, Godbersen, Esteban et al
Endocrinology (2020)
Cited by 15
AI Summary: OriGene’s Goat anti-RFP antibody (AB1140-100) was used in this study to detect tdTomato, facilitating the identification of specific cell populations during the investigation of miR-7a2’s role in prolactin regulation.
Snippet: Rabbit anti-ACTH (ab74976) 42 was purchased from Abcam. Goat anti-RFP (AB1140-100) 43 was used to detect tdTomato and was purchased from Origene. Mouse anti-TH (sc-25269) 44 was purchased from Santa Cruz. Donkey
Showing 1-6 of 7 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
