OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Interleukin-2 / IL2 Human Protein

Be the first to review this product
SKU
DA3559
Interleukin-2 / IL2 human protein, 10 µg
Size:
10 ug
  $245.00
2 Weeks*
Bulk/Customize

Other products for "IL2 or NM_000586"

Specifications
Specifications
Product Data
Species Human
Expression Host E. coli
Predicted MW 15.4 kDa
Concentration lot specific
Purity > 98% by SDS-PAGE and Silver staining
Presentation State Purified
Buffer 50 mM Acetic Acid.
State: Lyophilized purified protein, without stabilizer
Bioactivity The ED50 as determined by the dose-dependent stimulation proliferation of of murine D10G4.1 cells in th erange of 0.1-0.5 ng/ml.
Endotoxin < 0.1 ng per µg of IL-2
Reconstitution Method The lyophilized Il-2 should be reconstituted in 50mM Acetic Acid to a concentration not less than 100 µg/ml. This solution can be diluted into other buffered solutions or stored at -20°C for future use.
Preparation Lyophilized protein, without buffer and stabilizer
Storage Store lyophilized product at 2 - 8 °C for up to one month or at -20°C for longer. Following reconstitution store in aliquots at -20 °C. Avoid repeated freezing and thawing.
Stability Shelf life: One year from despatch.
Shipping Ambient
Reference Data
RefSeq NP_000577
Locus ID 3558
UniProt ID P60568
Cytogenetics 4q27
Synonyms IL-2, TCGF
Summary This gene is a member of the interleukin 2 (IL2) cytokine subfamily which includes IL4, IL7, IL9, IL15, IL21, erythropoietin, and thrombopoietin. The protein encoded by this gene is a secreted cytokine produced by activated CD4+ and CD8+ T lymphocytes, that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine (IL2R) is a heterotrimeric protein complex whose gamma chain is also shared by IL4 and IL7. The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. provided by RefSeq, Sep 2020
Protein Categories Allergies and autoimmune diseases, Cytokines, Diabetes, Growth Factors, Secreated Proteins
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Allograft rejection, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Graft-versus-host disease, Jak-STAT signaling pathway, T cell receptor signaling pathway, Type I diabetes mellitus
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Long-term mitochondrial and metabolic impairment in lymphocytes of subjects who recovered after severe COVID-19
Gómez-Delgado, López-Pastor, González-Jiménez et al
Cell Biol Toxicol (2025) 41 (1), 27 DOI: 10.1007/s10565-024-09976-0
Cited by 4
AI Summary: OriGene's IL-2 human protein (DA3559) was used to stimulate lymphocytes in vitro, enabling the assessment of mitochondrial and metabolic function in recovered COVID-19 patients.
Snippet: were stimulated with 2 μg/mL of Spike Peptide Mix (SPM) (PepMix of SARS-CoV-2 Spike glycoprotein, PM-WCPV-S-1, JPT Peptide Technologies, Berlin, Germany), 50 U/mL of IL-2 human protein (DA3559, OriGene Technologies, Rockville, MD, US), and 2 μg/mL of CD28 (#16–0289-81, Thermo Fisher Scientific, Waltham, MA, US) for 48 h, to assess the metabolism of stimulated PBMCs, and with DMSO (used
FigureFigureFigure
Gene modified NK cell line as a powerful tool for evaluation of cloned TCRs for TCR-T cell therapy
Kobayashi, Ozawa, Hamana et al
Cell Immunol (2022) 383, 104656 DOI: 10.1016/j.cellimm.2022.104656
Cited by 1
AI Summary: OriGene contributed to this study by providing the cDNA of human IL-2 (NM_000586.2), which was used to genetically modify NK cells for evaluating TCR function.
Snippet: The cDNA of human IL-2 (NM_000586.2) was purchased from Origene, amplified with forward primer (catgccatggaccatgtacaggatgcaactcct) and reverse primer (acgcgtcgactcaagtcagtgttgagatgatgc), d
MAC-T Cells as a Tool to Evaluate Lentiviral Vector Construction Targeting Recombinant Protein Expression in Milk
Monzani, Guemra, Adona et al
Anim. Biotechnol. (2015) 26 (2), 136-42 DOI: 10.1080/10495398.2014.941468
Cited by 9
AI Summary: OriGene Technologies Inc. provided commercial vectors containing human CSF3 and IL2 cDNAs, which were used as templates for gene amplification in the construction of lentiviral vectors evaluated in this study.
Snippet: The commercial vectors containing the human CSF3 and IL2 cDNAs cloned (OriGene Technologies Inc.) were used as templates for amplification, and the NCBI Reference Sequences are NM_000759.2 and NM_000586.2, respectively. ... Cite SaveSaving
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products