RBP1 (NM_002899) Human Untagged Clone

SKU
SC327754
RBP1 (untagged)-Human retinol binding protein 1 cellular (RBP1) transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RBP1
Synonyms CRABP-I; CRBP; CRBP1; CRBPI; RBPC
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002899 edited
CTAAGCGGGGAGGAGCGACCGCTACAATGGATCCTCCCGCAGGCTTTGTGCGCGCTGGGA
ATCCAGCTGTCGCCGCCCCGCAGAGCCCCCTGTCCCCGGAGGGCGCTCATTTCCGGGCCG
CCCACCACCCGCGTAGCACCGGCAGCCGCTGTCCCGGCAGTCTCCAGCCGTCCCGTCCGC
TTGTGGCCAACTGGCTCCAGTCACTCCCCGAAATGCCAGTCGACTTCACTGGGTACTGGA
AGATGTTGGTCAACGAGAATTTCGAGGAGTACCTGCGCGCCCTCGACGTCAATGTGGCCT
TGCGCAAAATCGCCAACTTGCTGAAGCCAGACAAAGAGATCGTGCAGGACGGTGACCATA
TGATCATCCGCACGCTGAGCACTTTTAGGAACTACATCATGGACTTCCAGGTTGGGAAGG
AGTTTGAGGAGGATCTGACAGGCATAGATGACCGCAAGTGCATGACAACAGTGAGCTGGG
ACGGAGACAAGCTCCAGTGTGTGCAGAAGGGTGAGAAGGAGGGGCGTGGCTGGACCCAGT
GGATCGAGGGTGATGAGCTGCACCTGGAGATGAGAGTGGAAGGTGTGGTCTGCAAGCAAG
TATTCAAGAAGGTGCAGTGAGGCCCAGGCAGACAACCTTGTCCCAAGGAATCAGCAGGAT
GTGTGGGCCAGGATCCCCCTCTTTGCACAGCATGAGGCAAAAA
Restriction Sites Please inquire
ACCN NM_002899
Insert Size 916 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002899.3, NP_002890.2
RefSeq Size 916 bp
RefSeq ORF 594 bp
Locus ID 5947
UniProt ID P09455
Cytogenetics 3q23
Summary This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (1) encodes the longest isoform (a).
Write Your Own Review
You're reviewing:RBP1 (NM_002899) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214515 RBP1 (Myc-DDK-tagged)-Human retinol binding protein 1, cellular (RBP1), transcript variant 1 10 ug
$150.00
RC214515L1 Lenti ORF clone of Human retinol binding protein 1, cellular (RBP1), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC214515L2 Lenti ORF clone of Human retinol binding protein 1, cellular (RBP1), transcript variant 1, mGFP tagged 10 ug
$450.00
RC214515L3 Lenti ORF clone of Human retinol binding protein 1, cellular (RBP1), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC214515L4 Lenti ORF clone of Human retinol binding protein 1, cellular (RBP1), transcript variant 1, mGFP tagged 10 ug
$450.00
RG214515 RBP1 (tGFP-tagged) - Human retinol binding protein 1, cellular (RBP1), transcript variant 1 10 ug
$489.00
SC303248 RBP1 (untagged)-Human retinol binding protein 1, cellular (RBP1), transcript variant 1 10 ug
$150.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.