OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

C11orf68 (NM_001135635) Human Untagged Clone

Be the first to review this product
SKU
SC324902
C11orf68 (untagged)-Human chromosome 11 open reading frame 68 (C11orf68), transcript variant 1
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA362417 C11ORF68 Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "C11orf68 or NM_001135635"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C11orf68
Synonyms BLES03; P5326
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001135635, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGGCGGCGGCGGCGGCCGTGGCGGGGGTGGGGCGCGGTGGCGGTGGCGCGGAG
CCACGGCAGGAGCGGAGCCGGGCCCGGGGCTGGGCCGGCGTCGAACGCAGCGAAGGCCGG
AGCAGGATGGAACCAGGTGAGGAGCTGGAAGAGGAGGGCTCTCCAGGTGGCCGTGAGGAT
GGCTTCACCGCCGAGCACCTGGCTGCAGAGGCCATGGCAGCTGACATGGACCCCTGGCTA
GTGTTTGATGCCCGCACAACGCCTGCCACTGAGCTGGATGCCTGGCTGGCCAAGTACCCA
CCATCCCAAGTTACCCGCTATGGGGACCCCGGTTCACCCAACTCAGAGCCTGTGGGCTGG
ATTGCAGTGTATGGGCAGGGCTACAGCCCCAACTCCGGGGACGTGCAGGGCCTGCAGGCA
GCCTGGGAAGCTCTGCAGACCAGTGGGCGGCCCATCACACCGGGTACCCTGCGCCAGCTC
GCCATCACCCACCACGTGCTCTCGGGCAAGTGGCTTATGCATCTGGCACCGGGCTTCAAG
CTGGACCACGCCTGGGCTGGCATTGCCCGGGCCGTGGTTGAAGGCCAGCTTCAGGTGGCC
AAGGTGAGCCCACGTGCCAAGGAGGGTGGGCGCCAGGTCATCTGTGTTTACACGGACGAC
TTCACGGACCGCTTGGGTGTACTGGAGGCGGATTCAGCCATCCGTGCAGCGGGCATTAAG
TGCCTGCTCACCTACAAGCCTGATGTCTACACCTACCTGGGCATCTACCGGGCCAATCGC
TGGCACCTCTGCCCCACTCTCTATGAGAGCCGTTTCCAGCTTGGGGGTAGTGCCCGTGGC
TCCCGAGTGCTTGACCGTGCCAACAACGTGGAACTGACC
Restriction Sites Please inquire |
ACCN NM_001135635
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001135635.1, NP_001129107.1
RefSeq Size 1571 bp
RefSeq ORF 882 bp
Locus ID 83638
UniProt ID Q9H3H3
Cytogenetics 11q13.1
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001135635" in other vectors (4)
SKU Description Size Price
RC227913 C11orf68 (Myc-DDK-tagged)-Human chromosome 11 open reading frame 68 (C11orf68), transcript variant 1 10 ug
$330.00
RC227913L3 Lenti-ORF clone of C11orf68 (Myc-DDK-tagged)-Human chromosome 11 open reading frame 68 (C11orf68), transcript variant 1 10 ug
$630.00
RC227913L4 Lenti-ORF clone of C11orf68 (mGFP-tagged)-Human chromosome 11 open reading frame 68 (C11orf68), transcript variant 1 10 ug
$630.00
RG227913 C11orf68 (tGFP-tagged) - Human chromosome 11 open reading frame 68 (C11orf68), transcript variant 1 10 ug
$530.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products