OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MEK1 (MAP2K1) (NM_002755) Human Untagged Clone

Be the first to review this product
SKU
SC323696
MAP2K1 (untagged)-Kinase deficient mutant (K97M) of Human mitogen-activated protein kinase kinase 1 (MAP2K1)
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA506006 MAP2K1 mouse monoclonal antibody,clone OTI4E1 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MEK1 or NM_002755"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MEK1
Synonyms CFC3; MAPKK1; MEK1; MEL; MKK1; PRKMK1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC323696 sequence for NM_002755 edited (data generated by NextGen Sequencing)
ATGCCCAAGAAGAAGCCGACGCCCATCCAGCTGAACCCGGCCCCCGACGGCTCTGCAGTT
AACGGGACCAGCTCTGCGGAGACCAACTTGGAGGCCTTGCAGAAGAAGCTGGAGGAGCTA
GAGCTTGATGAGCAGCAGCGAAAGCGCCTTGAGGCCTTTCTTACCCAGAAGCAGAAGGTG
GGAGAACTGAAGGATGACGACTTTGAGAAGATCAGTGAGCTGGGGGCTGGCAATGGCGGT
GTGGTGTTCAAGGTCTCCCACAAGTCTTCTGGCCTGGTCATGGCCAGAATGCTAATTCAT
CTGGAGATCAAACCCGCAATCCGGAACCAGATCATAAGGGAGCTGCAGGTTCTGCATGAG
TGCAACTCTCCGTACATCGTGGGCTTCTATGGTGCGTTCTACAGCGATGGCGAGATCAGT
ATCTGCATGGAGCACATGGATGGAGGTTCTCTGGATCAAGTCCTGAAGAAAGCTGGAAGA
ATTCCTGAACAAATTTTAGGAAAAGTTAGCATTGCTGTAATAAAAGGCCTGACATATCTG
AGGGAGAAGCACAAGATCATGCACAGAGATGTCAAGCCCTCCAACATCCTAGTCAACTCC
CGTGGGGAGATCAAGCTCTGTGACTTTGGGGTCAGCGGGCAGCTCATCGACTCCATGGCC
AACTCCTTCGTGGGCACAAGGTCCTACATGTCGCCAGAAAGACTCCAGGGGACTCATTAC
TCTGTGCAGTCAGACATCTGGAGCATGGGACTGTCTCTGGTAGAGATGGCGGTTGGGAGG
TATCCCATCCCTCCTCCAGATGCCAAGGAGCTGGAGCTGATGTTTGGGTGCCAGGTGGAA
GGAGATGCGGCTGAGACCCCACCCAGGCCAAGGACCCCCGGGAGGCCCCTTAGCTCATAC
GGAATGGACAGCCGACCTCCCATGGCAATTTTTGAGTTGTTGGATTACATAGTCAACGAG
CCTCCTCCAAAACTGCCCAGTGGAGTGTTCAGTCTGGAATTTCAAGATTTTGTGAATAAA
TGCTTAATAAAAAACCCCGCAGAGAGAGCAGATTTGAAGCAACTCATGGTTCATGCTTTT
ATCAAGAGATCTGATGCTGAGGAAGTGGATTTTGCAGGTTGGCTCTGCTCCACCATCGGC
CTTAACCAGCCCAGCACACCAACCCATGCTGCTGGCGTCTAA

Clone variation with respect to NM_002755.3
265 c=>t;290 a=>t
5' Read Nucleotide Sequence
>OriGene 5' read for mutant NM_002755 unedited
GCCGCCGTTTGAGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGA
ACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTTGAGAGAGAGA
GAGGAAGGGAATCCCGGGCTGCCGAACCGCACGTTCAGCCCGCTCCGCTCCTGCAGGGCAGCCTTTCGGC
TCTCTGCGCGCGAAGCCGAGTCCCGGGCGGGTGGGGCGGGGGTCCACTGAGACCGCTACCGGCCCCTCGG
CGCTGACGGGACCGCGCGGGGGCGCACCCGCTGAAGGCAGCCCCGGGGCCCCGCGGGCCCGGACTTTGGT
CCTGCGCAGCGGGGCGCGGGGGCAGCGCAGCGGGGAGGAGCCAAGAAGGTGCTGCCCTTCCCCCGGAATT
GGGAGCCCCGTTACCCGGGTCCAAAAGGCCCAAAAGAAGCCCAACCCCCTTCCACCTGACCCCGGCCCCC
GCCGGCTTGGCAGTTAACGGGACCAGCTTTCGGGAACCAAACTGGGAGGCCTTGCAAAAAAACCTGGAGG
GCCTAACTTTGGTGACCACACGAAAAGCCCTTGGGCCTTTTTTACCCAACCAAGGGGGAAAACTGAGGAA
CACATTTGAAATATCGTGCCGGGCGCGGATGGGGGGTGTGTTAGGTCCCAATTCTGGCCGTGTGGGCCAT
GTGCATTCTGGATATACCCATCTGGACCATACAGAGACCGCGCTCTGATCGGACACTCCACTAGGGTCTA
GGGGGGCT
Kinase Domain Sequence
>SC323696 kinase domain raw sequence. By performing BLASTX analysis with this sequence against NCBI refernce protein database, you can confirm the presence of the kinase-deficient mutation
CYCTGMGCAATGGGCGKAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCA
GAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTTGAGAGAGAGAGAGGAAG
GGAATCCCGGGCTGCCGAACCGCACGTTCAGCCCGCTCCGCTCCTGCAGGGCAGCCTTTCGGCTCTCTGC
GCGCGAAGCCGAGTCCCGGGCGGGTGGGGCGGGGGTCCACTGAGA
Restriction Sites Please inquire |
ACCN NM_002755
Insert Size 2550 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002755.2, NP_002746.1
RefSeq Size 2222 bp
RefSeq ORF 1182 bp
Locus ID 5604
UniProt ID Q02750
Cytogenetics 15q22.31
Domains pkinase, S_TKc, TyrKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Acute myeloid leukemia, B cell receptor signaling pathway, Bladder cancer, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Dorso-ventral axis formation, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Gap junction, Glioma, GnRH signaling pathway, Insulin signaling pathway, Long-term depression, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Melanoma, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non-small cell lung cancer, Oocyte meiosis, Pancreatic cancer, Pathways in cancer, Prion diseases, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway, Thyroid cancer, Toll-like receptor signaling pathway, Vascular smooth muscle contraction, VEGF signaling pathway
Summary The protein encoded by this gene is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein kinase lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, this kinase is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002755" in other vectors (7)
SKU Description Size Price
RC218460 MAP2K1 (Myc-DDK-tagged)-Human mitogen-activated protein kinase kinase 1 (MAP2K1) 10 ug
$457.00
RC218460L1 Lenti ORF clone of Human mitogen-activated protein kinase kinase 1 (MAP2K1), Myc-DDK-tagged 10 ug
$757.00
RC218460L2 Lenti ORF clone of Human mitogen-activated protein kinase kinase 1 (MAP2K1), mGFP tagged 10 ug
$757.00
RC218460L3 Lenti ORF clone of Human mitogen-activated protein kinase kinase 1 (MAP2K1), Myc-DDK-tagged 10 ug
$757.00
RC218460L4 Lenti ORF clone of Human mitogen-activated protein kinase kinase 1 (MAP2K1), mGFP tagged 10 ug
$757.00
RG218460 MAP2K1 (tGFP-tagged) - Human mitogen-activated protein kinase kinase 1 (MAP2K1) 10 ug
$489.00 $657.00
SC118424 MAP2K1 (untagged)-Human mitogen-activated protein kinase kinase 1 (MAP2K1) 10 ug
$457.00

file-alt Citations

MEK1 promotes YAP and their interaction is critical for tumorigenesis in liver cancer
Li, Wang, Zhang et al
FEBS Lett. (2013)
Cited by 42
AI Summary: OriGene contributed to this study by providing the MEK1 cDNA, which was used to generate MEK1-HA constructs for investigating the interaction between MEK1 and YAP in liver cancer.
Snippet: MEK1-HA was amplified by PCR from corresponding cDNA purchased from Origene (Beijing, China) and subcloned into pcDNA3.1(+) using following primers: Forward: gattggatccatgcccaagaagaagccgacgcccatc and Reward ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products