OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SAR1B (NM_016103) Human Untagged Clone

Be the first to review this product
SKU
SC320117
SAR1B (untagged)-Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA349246 Rabbit Polyclonal Anti-SAR1B Antibody
100 ul
$205.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SAR1B or NM_016103"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SAR1B
Synonyms ANDD; CMRD; GTBPB; SARA2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_016103.2 GCCGGCCCGGAAGGGGCTGATGCGAACTGGGGCCACGGCAGCCATCGCGCTTTGCAGTTC
GGTCTCCTGGTGTACGGCCAACGCCAAGTAGGGGATTGCGTTCCCTCCAGTCGCAGACCC
TATCAGATTTGGATATGTCCTTCATATTTGATTGGATTTACAGTGGTTTCAGCAGTGTGC
TACAGTTTTTAGGATTATATAAGAAAACTGGTAAACTGGTATTTCTTGGATTGGATAATG
CAGGAAAAACAACATTGCTACACATGCTAAAAGATGACAGACTTGGACAACATGTCCCAA
CATTACATCCCACTTCCGAAGAACTGACCATTGCTGGCATGACGTTTACAACTTTTGATC
TGGGTGGACATGTTCAAGCTCGAAGAGTGTGGAAAAACTACCTTCCTGCTATCAATGGCA
TTGTATTTCTGGTGGATTGTGCAGACCACGAAAGGCTGTTAGAGTCAAAAGAAGAACTTG
ATTCACTAATGACAGATGAAACCATTGCTAATGTGCCTATACTGATTCTTGGGAATAAGA
TCGACAGACCTGAAGCCATCAGTGAAGAGAGGTTGCGAGAGATGTTTGGTTTATATGGTC
AGACAACAGGAAAGGGGAGTATATCTCTGAAAGAACTGAATGCCCGACCCTTAGAAGTTT
TCATGTGTAGTGTGCTCAAAAGACAAGGTTACGGAGAAGGCTTCCGCTGGATGGCACAGT
ACATTGATTAACACAAACTCACATTGGTTCCAGGTCTCAACGTTCAGGCTTACTCAGAGA
TTTGATTGCTCAACATGCATAACTTGAATTCAATAGACTTTTGCTGGTTATAAAACAGAT
GTTTTTTAGATTATTAATATTAAATCAACTTAATTTGAATGAGAATTGAAAACTGATTCA
AGTAAGTTTGAGTATCACAATGTTAGCTTTCTAATTCCATAAAAGTACTTGGTTTTTACA
GTTTATAATCTGACATCACCCCAGCGCCATTTGTAAAGAGCAACTTTCCAGCAGTACATT
TGAAGCACTTTTTAACAACATGAAACTATAAACCATATTTAAAAGCTCATCATGTTAAAT
TTTTTATGTACTTTTCTGGAACTAGTTTTTAAATTTTAGATTATATGTCCACCTATCTTA
AGTGTACAGTTAATAATTAGCTTATTCAATGATTGCATGATGCCTTACAGTTTTCAATAA
CTTTTTTTCTTATGCAAACGTCATGCAATAAAACAAACTCTAATGTTTGCCAAAAAAAAA
AAAAA
Restriction Sites Please inquire |
ACCN NM_016103
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016103.2, NP_057187.1
RefSeq Size 1258 bp
RefSeq ORF 597 bp
Locus ID 51128
UniProt ID Q9Y6B6
Cytogenetics 5q31.1
Domains arf, ARF, SAR
Summary The protein encoded by this gene is a small GTPase that acts as a homodimer. The encoded protein is activated by the guanine nucleotide exchange factor PREB and is involved in protein transport from the endoplasmic reticulum to the Golgi. This protein is part of the COPII coat complex. Defects in this gene are a cause of chylomicron retention disease (CMRD), also known as Anderson disease (ANDD). Two transcript variants encoding the same protein have been found for this gene. provided by RefSeq, Mar 2010
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_016103" in other vectors (6)
SKU Description Size Price
RC210593 SAR1B (Myc-DDK-tagged)-Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 2 10 ug
$300.00
RC210593L1 Lenti ORF clone of Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC210593L2 Lenti ORF clone of Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 2, mGFP tagged 10 ug
$600.00
RC210593L3 Lenti ORF clone of Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC210593L4 Lenti ORF clone of Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 2, mGFP tagged 10 ug
$600.00
RG210593 SAR1B (tGFP-tagged) - Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 2 10 ug
$489.00 $500.00

file-alt Citations

New Insights in Intestinal Sar1B GTPase Regulation and Role in Cholesterol Homeostasis
Sané, Seidman, Spahis et al
J. Cell. Biochem. (2015)
Cited by 11
AI Summary: OriGene’s Human cDNA clone SC114457 was used as the template to amplify the SAR1B gene, enabling the study of Sar1B GTPase’s role in cholesterol regulation in intestinal cells.
Snippet: The blunt-end PCR fragment encoding SAR1B gene was amplified from the Human cDNA clone SC114457 (Origene Technologies, Rockville, MD) with ATGTCCTTCATATTTG as forward primer and CAGATCCTCTTCTGAGATGAGTTTTTGTTCATCAATGTTACTGTGCCAT ... Cite SaveSaving
Tissue Distribution and Regulation of the Small Sar1b GTPase in Mice
Marcil, Seidman, Sinnett et al
Cell. Physiol. Biochem. (2014) 33 (6), 1815-1826 DOI: 10.1159/000362960
Cited by 11
AI Summary: OriGene's pCMV6-XL4 vector containing full-length SAR1B cDNA was used to generate Sar1b transgenic mice, enabling the study of Sar1b tissue distribution and regulation in this research.
Snippet: goto top of outline Materials and Methods goto top of outline Generation of Sar1b transgenic mice. The pCMV6-XL4 vector (OriGene Technologies, Rockville, MD), harbouring full length cDNA of SAR1B, was digested with NotI to excise a 1960 bp fragment. ... Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products