OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

USP22 (NM_015276) Human Untagged Clone

Be the first to review this product
SKU
SC316543
USP22 (untagged)-Human ubiquitin specific peptidase 22 (USP22)
  $734.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA344368 Rabbit Polyclonal Anti-USP22 Antibody - middle region
100 ul
$585.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "USP22 or NM_015276"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol USP22
Synonyms USP3L
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_015276 edited
ATGGTGTCCCGGCCAGAGCCCGAGGGCGAGGCCATGGACGCCGAGCTGGCGGTAGCGCCG
CCGGGCTGCTCGCACCTGGGCAGCTTCAAGGTGGACAACTGGAAGCAGAACCTGCGGGCC
ATCTACCAGTGCTTCGTGTGGAGCGGCACGGCTGAGGCCCGCAAGCGCAAGGCCAAGTCC
TGTATCTGCCATGTCTGTGGCGTCCACCTCAACAGGCTGCATTCCTGCCTCTACTGTGTC
TTCTTCGGCTGTTTCACAAAGAAGCATATTCACGAGCATGCGAAGGCGAAGCGGCACAAC
CTGGCCATTGATCTGATGTATGGAGGCATCTACTGTTTTCTGTGCCAGGACTACATCTAT
GACAAAGACATGGAAATAATCGCCAAGGAGGAGCAGCGAAAAGCTTGGAAAATGCAAGGC
GTTGGAGAGAAGTTTTCAACTTGGGAACCAACCAAACGGGAGCTTGAACTGCTGAAGCAC
AACCCGAAAAGGAGAAAGATCACCTCGAACTGCACCATAGGTCTGCGTGGGCTGATCAAC
CTTGGGAACACATGCTTCATGAACTGCATCGTGCAGGCCCTGACCCACACGCCACTTCTG
CGGGACTTCTTCCTGTCTGACAGGCACCGCTGTGAGATGCAGAGCCCCAGCTCCTGTCTG
GTCTGTGAGATGTCCTCACTGTTTCAGGAGTTTTACTCTGGACACCGGTCCCCTCACATC
CCGTATAAGTTGCTGCACCTGGTGTGGACCCACGCGAGGCACCTAGCAGGCTACGAGCAG
CAGGACGCCCACGAGTTCCTCATCGCGGCCCTGGACGTGCTCCACCGACACTGCAAAGGT
GATGACAATGGGAAGAAGGCCAACAACCCCAACCACTGCAACTGCATCATAGACCAGATC
TTCACAGGCGGGTTGCAGTCAGACGTCACCTGCCAAGTCTGCCATGGAGTCTCCACCACC
ATCGACCCCTTCTGGGACATCAGCTTGGATCTCCCCGGCTCTTCCACCCCATTCTGGCCC
CTGAGCCCAGGGAGCGAGGGCAACGTGGTAAACGGGGAAAGCCACGTGTCGGGAACCACC
ACGCTCACGGACTGCCTGCGACGATTCACCAGACCAGAGCACTTGGGCAGCAGCGCCAAG
ATCAAGTGCAGCGGTTGCCATAGCTACCAGGAGTCCACAAAGCAGCTCACTATGAAGAAA
CTGCCCATCGTAGCCTGTTTTCATCTCAAACGATTTGAACACTCAGCCAAGCTGCGGCGG
AAGATCACCACGTATGTGTCCTTCCCCCTGGAGCTGGACATGACCCCTTTCATGGCCTCC
AGCAAAGAGAGCAGGATGAATGGACAGTACCAGCAGCCCACGGACAGTCTCAACAATGAC
AACAAGTATTCCCTGTTTGCTGTTGTTAACCATCAAGGGACCTTGGAGAGTGGCCACTAC
ACCAGCTTTATCCGGCAGCACAAAGACCAGTGGTTCAAGTGTGACGATGCCATCATCACC
AAGGCCAGCATCAAGGACGTCCTGGACAGCGAAGGGTACTTGCTGTTCTATCACAAACAG
TTCCTGGAATACGAGTAG
Restriction Sites NotI-NotI |
ACCN NM_015276
Insert Size 5000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation ORF was fully sequenced and the sequence matches with that of NM_015276.1.One SNP was observed in the ORF, which does not change amino acid.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015276.1, NP_056091.1
RefSeq Size 5220 bp
RefSeq ORF 1578 bp
Locus ID 23326
UniProt ID Q9UPT9
Cytogenetics 17p11.2
Protein Families Protease
Summary Histone deubiquitinating component of the transcription regulatory histone acetylation (HAT) complex SAGA. Catalyzes the deubiquitination of both histones H2A and H2B, thereby acting as a coactivator. Recruited to specific gene promoters by activators such as MYC, where it is required for transcription. Required for nuclear receptor-mediated transactivation and cell cycle progression.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_015276" in other vectors (6)
SKU Description Size Price
RC219906 USP22 (Myc-DDK-tagged)-Human ubiquitin specific peptidase 22 (USP22) 10 ug
$733.00
RC219906L1 Lenti ORF clone of Human ubiquitin specific peptidase 22 (USP22), Myc-DDK-tagged 10 ug
$1,033.00
RC219906L2 Lenti ORF clone of Human ubiquitin specific peptidase 22 (USP22), mGFP tagged 10 ug
$1,033.00
RC219906L3 Lenti ORF clone of Human ubiquitin specific peptidase 22 (USP22), Myc-DDK-tagged 10 ug
$1,033.00
RC219906L4 Lenti ORF clone of Human ubiquitin specific peptidase 22 (USP22), mGFP tagged 10 ug
$1,033.00
RG219906 USP22 (tGFP-tagged) - Human ubiquitin specific peptidase 22 (USP22) 10 ug
$933.00

file-alt Citations

USP22 acts as an oncogene by regulating the stability of cyclooxygenase-2 in non-small cell lung cancer
Xiao, Tian, Yang et al
Biochem. Biophys. Res. Commun. (2015)
Cited by 37
AI Summary: OriGene Technologies contributed to the study by providing the USP22 cDNA in the pCMV6-XL5 plasmid, which was used to investigate the role of USP22 in regulating COX-2 stability in non-small cell lung cancer.
Snippet: COX-2 expression. 2. Materials and Methods. 2.1. Plasmids and proteins. The cDNA for USP22 in pCMV6-XL5 was obtained from Origene Technologies and used as a template to generate pcDNA3-USP22. pcDNA3-USP22 ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products