OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

LYPD1 (NM_001077427) Human Untagged Clone

Be the first to review this product
SKU
SC315466
LYPD1 (untagged)-Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "LYPD1 or NM_001077427"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LYPD1
Synonyms LYPDC1; PHTS
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001077427 edited
ATGTGTCAGAAAGAAGTGATGGAGCAAAGTGCCGGGATCATGTACCGCAAGTCCTGTGCA
TCATCAGCGGCCTGTCTCATCGCCTCTGCCGGGTACCAGTCCTTCTGCTCCCCAGGGAAA
CTGAACTCAGTTTGCATCAGCTGCTGCAACACCCCTCTTTGTAACGGGCCAAGGCCCAAG
AAAAGGGGAAGTTCTGCCTCGGCCCTCAGGCCAGGGCTCCGCACCACCATCCTGTTCCTC
AAATTAGCCCTCTTCTCGGCACACTGCTGA
Restriction Sites NotI-NotI |
ACCN NM_001077427
Insert Size 1600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001077427.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001077427.1, NP_001070895.1
RefSeq Size 1814 bp
RefSeq ORF 270 bp
Locus ID 116372
UniProt ID Q8N2G4
Cytogenetics 2q21.2
Protein Families Druggable Genome, Transmembrane
Summary Believed to act as a modulator of nicotinic acetylcholine receptors (nAChRs) activity. In vitro increases receptor desensitization and decreases affinity for ACh of alpha-4:beta-2-containing nAChRs. May play a role in the intracellular trafficking of alpha-4:beta-2 and alpha-7-containing nAChRs and may inhibit their expression at the cell surface. May be involved in the control of anxiety.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) contains a different segment for its 5' UTR and 5' coding region, compared to variant 1. This results in translation initiation at a downstream AUG and a protein (isoform b) with a shorter N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001077427" in other vectors (6)
SKU Description Size Price
RC220675 LYPD1 (Myc-DDK-tagged)-Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2 10 ug
$150.00
RC220675L1 Lenti ORF clone of Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC220675L2 Lenti ORF clone of Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2, mGFP tagged 10 ug
$450.00
RC220675L3 Lenti ORF clone of Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC220675L4 Lenti ORF clone of Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2, mGFP tagged 10 ug
$450.00
RG220675 LYPD1 (tGFP-tagged) - Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products