OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ARNTL2 (NM_020183) Human Untagged Clone

Be the first to review this product
SKU
SC314284
ARNTL2 (untagged)-Human aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2)
  $593.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA345278 Rabbit Polyclonal Anti-ARNTL2 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ARNTL2 or NM_020183"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ARNTL2
Synonyms bHLHe6; BMAL2; CLIF; MOP9; PASD9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_020183, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGGAAGAGGAGGCTGCGGCGGGAGGTAAAGTGTTGAGAGAGGAGAACCAGTGCATTGCTCCTG
TGGTTTCCAGCCGCGTGAGTCCAGGGACAAGACCAACAGCTATGGGGTCTTTCAGCTCACACATGACAGA
GTTTCCACGAAAACGCAAAGGAAGTGATTCAGACCCATCCCAGTCAGGAATCATGACAGAAAAAGTGGTG
GAAAAGCTTTCTCAGAATCCCCTTACCTATCTTCTTTCAACAAGGATAGAAATATCAGCCTCCAGTGGCA
GCAGAGTGGAAGATGGTGAACACCAAGTTAAAATGAAGGCCTTCAGAGAAGCTCATAGCCAAACTGAAAA
GCGGAGGAGAGATAAAATGAATAACCTGATTGAAGAACTGTCTGCAATGATCCCTCAGTGCAACCCCATG
GCGCGTAAACTGGACAAACTTACAGTTTTAAGAATGGCTGTTCAACACTTGAGATCTTTAAAAGGCTTGA
CAAATTCTTATGTGGGAAGTAATTATAGACCATCATTTCTTCAGGATAATGAGCTCAGACATTTAATCCT
TAAGACTGCAGAAGGCTTCTTATTTGTGGTTGGATGTGAAAGAGGAAAAATTCTCTTCGTTTCTAAGTCA
GTCTCCAAAATACTTAATTATGATCAGGCTAGTTTGACTGGACAAAGCTTATTTGACTTCTTACATCCAA
AAGATGTTGCCAAAGTAAAGGAACAACTTTCTTCTTTTGATATTTCACCAAGAGAAAAGCTAATAGATGC
CAAAACTGGTTTGCAAGTTCACAGTAATCTCCACGCTGGAAGGACACGTGTGTATTCTGGCTCAAGACGA
TCTTTTTTCTGTCGGATAAAGAGTTGTAAAATCTCTGTCAAAGAAGAGCATGGATGCTTACCCAACTCAA
AGAAGAAAGAGCACAGAAAATTCTATACTATCCATTGCACTGGTTACTTGAGAAGCTGGCCTCCAAATAT
TGTTGGAATGGAAGAAGAAAGGAACAGTAAGAAAGACAACAGTAATTTTACCTGCCTTGTGGCCATTGGA
AGATTACAGCCATATATTGTTCCACAGAACAGTGGAGAGATTAATGTGAAACCAACTGAATTTATAACCC
GGTTTGCAGTGAATGGAAAATTTGTCTATGTAGATCAAAGGGCAACAGCGATTTTAGGATATCTGCCTCA
GGAACTTTTGGGAACTTCTTGTTATGAATATTTTCATCAAGATGACCACAATAATTTGACTGACAAGCAC
AAAGCAGTTCTACAGAGTAAGGAGAAAATACTTACAGATTCCTACAAATTCAGAGCAAAAGATGGCTCTT
TTGTAACTTTAAAAAGCCAATGGTTTAGTTTCACAAATCCTTGGACAAAAGAACTGGAATATATTGTATC
TGTCAACACTTTAGTTTTGGGACATAGTGAGCCTGGAGAAGCATCATTTTTACCTTGTAGCTCTCAATCA
TCAGAAGAATCCTCTAGACAGTCCTGTATGAGTGTACCTGGAATGTCTACTGGAACAGTACTTGGTGCTG
GTAGTATTGGAACAGATATTGCAAATGAAATTCTGGATTTACAGAGGTTACAGTCTTCTTCATACCTTGA
TGATTCGAGTCCAACAGGTTTAATGAAAGATACTCATACTGTAAACTGCAGGAGTATGTCAAATAAGGAG
TTGTTTCCACCAAGTCCTTCTGAAATGGGGGAGCTAGAGGCTACCAGGCAAAACCAGAGTACTGTTGCTG
TCCACAGCCATGAGCCACTCCTCAGTGATGGTGCACAGTTGGATTTCGATGCCCTATGTGACAATGATGA
CACAGCCATGGCTGCATTTATGAATTACTTAGAAGCAGAGGGGGGCCTGGGAGACCCTGGGGACTTCAGT
GACATCCAGTGGACCCTCTAG
Restriction Sites Please inquire |
ACCN NM_020183
Insert Size 1900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020183.3, NP_064568.3
RefSeq Size 1930 bp
RefSeq ORF 1911 bp
Locus ID 56938
UniProt ID Q8WYA1
Cytogenetics 12p11.23
Domains HLH, PAS
Protein Families Druggable Genome, Transcription Factors
Summary This gene encodes a basic helix-loop-helix transcription factor belonging to the PAS (PER, ARNT, SIM) superfamily. The PAS proteins play important roles in adaptation to low atmospheric and cellular oxygen levels, exposure to certain environmental pollutants, and diurnal oscillations in light and temperature. This protein forms a transcriptionally active heterodimer with the circadian CLOCK protein, the structurally related MOP4, and hypoxia-inducible factors, such as HIF1alpha. Consistent with its role as a biologically relevant partner of circadian and hypoxia factors, this protein is coexpressed in regions of the brain such as the thalamus, hypothalamus, and amygdala. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. provided by RefSeq, Oct 2011
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_020183" in other vectors (6)
SKU Description Size Price
RC216969 ARNTL2 (Myc-DDK-tagged)-Human aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2) 10 ug
$289.00 $592.00
RC216969L1 Lenti ORF clone of Human aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2), Myc-DDK-tagged 10 ug
$892.00
RC216969L2 Lenti ORF clone of Human aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2), mGFP tagged 10 ug
$892.00
RC216969L3 Lenti ORF clone of Human aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2), Myc-DDK-tagged 10 ug
$892.00
RC216969L4 Lenti ORF clone of Human aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2), mGFP tagged 10 ug
$892.00
RG216969 ARNTL2 (tGFP-tagged) - Human aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2) 10 ug
$792.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products