OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Osteocalcin (BGLAP) (NM_199173) Human Untagged Clone

Be the first to review this product
SKU
SC307883
BGLAP (untagged)-Human bone gamma-carboxyglutamate (gla) protein (BGLAP)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA321966 Anti-BGLAP Rabbit Polyclonal Antibody
100 ul
$305.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Osteocalcin or NM_199173"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Osteocalcin
Synonyms BGP; OC; OCN
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_199173 edited
ACACCATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTG
GCCAGGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGCCTTTGTGTCCA
AGCAGGAGGGCAGCGAGGTAGTGAAGAGACCCAGGCGCTACCTGTATCAATGGCTGGGAG
CCCCAGTCCCCTACCCGGATCCCCTGGAGCCCAGGAGGGAGGTGTGTGAGCTCAATCCGG
ACTGTGACGAGTTGGCTGACCACATCGGCTTTCAGGAGGCCTATCGGCGCTTCTACGGCC
CGGTCTAGGGTGTCGCTCTGCTGGCCTGGCCGGCAACCCCAGTTCTGCTCCTCTCCAGGC
ACCCTTCTTTCCT
Restriction Sites Please inquire |
ACCN NM_199173
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation ORF of this clone is a perfect match to the reference, NM_199173.2
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_199173.2, NP_954642.1
RefSeq Size 498 bp
RefSeq ORF 303 bp
Locus ID 632
UniProt ID P02818
Cytogenetics 1q22
Protein Families ES Cell Differentiation/IPS, Secreted Protein
Summary This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product. provided by RefSeq, Jun 2015
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_199173" in other vectors (4)
SKU Description Size Price
RC220555 BGLAP (Myc-DDK-tagged)-Human bone gamma-carboxyglutamate (gla) protein (BGLAP) 10 ug
$150.00
RC220555L3 Lenti ORF clone of Human bone gamma-carboxyglutamate (gla) protein (BGLAP), Myc-DDK-tagged 10 ug
$450.00
RC220555L4 Lenti ORF clone of Human bone gamma-carboxyglutamate (gla) protein (BGLAP), mGFP tagged 10 ug
$450.00
RG220555 BGLAP (tGFP-tagged) - Human bone gamma-carboxyglutamate (gla) protein (BGLAP) 10 ug
$350.00

file-alt Citations

Molecular mechanisms of allosteric inhibition of brain glycogen phosphorylase by neurotoxic dithiocarbamate chemicals
Mathieu, Bui, Petit et al
J. Biol. Chem. (2016)
AI Summary: OriGene’s pCMV6-XL4 vector containing human bGP cDNA was used for cloning and site-directed mutagenesis, enabling the expression and functional analysis of brain glycogen phosphorylase in this study.
Snippet: METHODS Cloning and site directed mutagenesis The human bGP cDNA was obtained in the eukaryotic pCMV6-XL4 vector (provided by OriGene Technologies, Inc) and sub-cloned into the pET28a vector for expression and purification of recombinant bGPs. ... Cite SaveSaving
Insights into Brain Glycogen Metabolism: The Structure of Human Brain Glycogen Phosphorylase
Mathieu, Li de la Sierra-Gallay, Duval et al
J. Biol. Chem. (2016)
AI Summary: OriGene Technologies contributed to this study by providing the human brain glycogen phosphorylase (bGP) cDNA, which was used for cloning and expression of recombinant bGP protein.
Snippet: Cloning of bGP and expression of recombinant bGP— The human bGP cDNA (provided by OriGene Technologies, Inc) was subcloned into the pET28a vector for further expression of His6-tagged fusion recombinant proteins (6xHis-bGP). ... Cite SaveSaving
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products