OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ghrelin Receptor (GHSR) (NM_198407) Human Untagged Clone

Be the first to review this product
SKU
SC307691
GHSR (untagged)-Human growth hormone secretagogue receptor (GHSR), transcript variant 1a
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA316777 Ghrelin Receptor / GHSR Rabbit Polyclonal (N-Terminus) Antibody
50 ug
$550.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ghrelin Receptor or NM_198407"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Ghrelin Receptor
Synonyms GHDP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_198407 edited
ATGTGGAACGCGACGCCCAGCGAAGAGCCGGGGTTCAACCTCACACTGGCCGACCTGGAC
TGGGATGCTTCCCCCGGCAACGACTCGCTGGGCGACGAGCTGCTGCAGCTCTTCCCCGCG
CCGCTGCTGGCGGGCGTCACAGCCACCTGCGTGGCACTCTTCGTGGTGGGTATCGCTGGC
AACCTGCTCACCATGCTGGTGGTGTCGCGCTTCCGCGAGCTGCGCACCACCACCAACCTC
TACCTGTCCAGCATGGCCTTCTCCGATCTGCTCATCTTCCTCTGCATGCCCCTGGACCTC
GTTCGCCTCTGGCAGTACCGGCCCTGGAACTTCGGCGACCTCCTCTGCAAACTCTTCCAA
TTCGTCAGTGAGAGCTGCACCTACGCCACGGTGCTCACCATCACAGCGCTGAGCGTCGAG
CGCTACTTCGCCATCTGCTTCCCACTCCGGGCCAAGGTGGTGGTCACCAAGGGGCGGGTG
AAGCTGGTCATCTTCGTCATCTGGGCCGTGGCCTTCTGCAGCGCCGGGCCCATCTTCGTG
CTAGTCGGGGTGGAGCACGAGAACGGCACCGACCCTTGGGACACCAACGAGTGCCGCCCC
ACCGAGTTTGCGGTGCGCTCTGGACTGCTCACGGTCATGGTGTGGGTGTCCAGCATCTTC
TTCTTCCTTCCTGTCTTCTGTCTCACGGTCCTCTACAGTCTCATCGGCAGGAAGCTGTGG
CGGAGGAGGCGCGGCGATGCTGTCGTGGGTGCCTCGCTCAGGGACCAGAACCACAAGCAA
ACCGTGAAAATGCTGGCTGTAGTGGTGTTTGCCTTCATCCTCTGCTGGCTCCCCTTCCAC
GTAGGGCGATATTTATTTTCCAAATCCTTTGAGCCTGGCTCCTTGGAGATTGCTCAGATC
AGCCAGTACTGCAACCTCGTGTCCTTTGTCCTCTTCTACCTCAGTGCTGCCATCAACCCC
ATTCTGTACAACATCATGTCCAAGAAGTACCGGGTGGCAGTGTTCAGACTTCTGGGATTC
GAACCCTTCTCCCAGAGAAAGCTCTCCACTCTGAAAGATGAAAGTTCTCGGGCCTGGACA
GAATCTAGTATTAATACATGA
Restriction Sites Please inquire |
ACCN NM_198407
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198407.1, NP_940799.1
RefSeq Size 1101 bp
RefSeq ORF 1101 bp
Locus ID 2693
UniProt ID Q92847
Cytogenetics 3q26.31
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Summary This gene encodes a member of the G-protein coupled receptor family. The encoded protein may play a role in energy homeostasis and regulation of body weight. Two identified transcript variants are expressed in several tissues and are evolutionary conserved in fish and swine. One transcript, 1a, excises an intron and encodes the functional protein; this protein is the receptor for the Ghrelin ligand and defines a neuroendocrine pathway for growth hormone release. The second transcript (1b) retains the intron and does not function as a receptor for Ghrelin; however, it may function to attenuate activity of isoform 1a. Mutations in this gene are associated with autosomal idiopathic short stature.provided by RefSeq, Apr 2010
Transcript Variant: This variant (1a), also known as GHS-R1a, represents the completely spliced transcript, and encodes the longer isoform (1a). This transcript has been shown to encode a functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_198407" in other vectors (6)
SKU Description Size Price
RC220392 GHSR (Myc-DDK-tagged)-Human growth hormone secretagogue receptor (GHSR), transcript variant 1a 10 ug
$289.00 $457.00
RC220392L1 Lenti ORF clone of Human growth hormone secretagogue receptor (GHSR), transcript variant 1a, Myc-DDK-tagged 10 ug
$757.00
RC220392L2 Lenti ORF clone of Human growth hormone secretagogue receptor (GHSR), transcript variant 1a, mGFP tagged 10 ug
$757.00
RC220392L3 Lenti ORF clone of Human growth hormone secretagogue receptor (GHSR), transcript variant 1a, Myc-DDK-tagged 10 ug
$757.00
RC220392L4 Lenti ORF clone of Human growth hormone secretagogue receptor (GHSR), transcript variant 1a, mGFP tagged 10 ug
$757.00
RG220392 GHSR (tGFP-tagged) - Human growth hormone secretagogue receptor (GHSR), transcript variant 1a 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products