OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SLURP1 (NM_020427) Human Untagged Clone

Be the first to review this product
SKU
SC304764
SLURP1 (untagged)-Human secreted LY6/PLAUR domain containing 1 (SLURP1)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SLURP1 or NM_020427"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SLURP1
Synonyms ANUP; ARS; ArsB; LY6-MT; LY6LS; MDM
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_020427 edited
CTCTCATCACTTCTGAGCACGGAGCAATGGCCTCTCGCTGGGCTGTGCAGCTGCTGCTCG
TGGCAGCCTGGAGCATGGGCTGTGGTGAGGCCCTCAAGTGCTACACCTGCAAGGAGCCCA
TGACCAGTGCTTCCTGCAGGACCATTACCCGCTGCAAGCCAGAGGACACAGCCTGCATGA
CCACGCTGGTGACGGTGGAGGCAGAGTACCCCTTCAACCAGAGCCCCGTGGTGACCCGCT
CCTGCTCCAGCTCCTGTGTGGCCACCGACCCCGACAGCATCGGGGCCGCCCACCTGATCT
TCTGCTGCTTCCGAGACCTCTGCAACTCGGAACTCTGAACCCAGGGCGGCAGGGCGGAAG
GTGCTCCTCAGGCACCTCCTCTCTGACGG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_020427 unedited
GTCACCATTTGTAAACGACTCACTATAGGCGGCCGCGNATTCCTGCANCCCGGGGGATCC
GCCCCTCTCATCACTTCTGAGCACGGAGCAATGGCCTCTCGCTGGGCTGTGCAGCTGCTG
CTCGTGGCAGCCTGGAGCATGGGCTGTGGTGAGGCCCTCAAGTGCTACACCTGCAAGGAG
CCCATGACCAGTGCTTCCTGCAGGACCATTACCCGCTGCAAGCCAGAGGACACAGCCTGC
ATGACCACGCTGGTGACGGTGGAGGCAGAGTACCCCTTCAACCAGAGCCCCGTGGTGACC
CGCTCCTGCTCCAGCTCCTGTGTGGCCACCGACCCCGACAGCATCGGGGCCGCCCACCTG
ATCTTCTGCTGCTTCCGAGACCTCTGCAACTCGGAACTCTGAACCCAGGGCGGCAGGGCG
GAAGGTGCTCCTCAGGCACCTCCTCTCTGACGGGCTAGAGCGGCCGCGGTCATAGCTGTT
TCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTG
GAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTG
TCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGGAGCAAGGG
GCAAGTTGGGAAAACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGC
AGTGGCACAATTCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGC
CTCAACCTCCCCAATTGTTGGGATTCCAGCCTGCCTGAA
Restriction Sites Please inquire |
ACCN NM_020427
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020427.2, NP_065160.1
RefSeq Size 537 bp
RefSeq ORF 312 bp
Locus ID 57152
UniProt ID P55000
Cytogenetics 8q24.3
Protein Families Druggable Genome, Secreted Protein
Summary The protein encoded by this gene is a member of the Ly6/uPAR family but lacks a GPI-anchoring signal sequence. It is thought that this secreted protein contains antitumor activity. Mutations in this gene have been associated with Mal de Meleda, a rare autosomal recessive skin disorder. This gene maps to the same chromosomal region as several members of the Ly6/uPAR family of glycoprotein receptors. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_020427" in other vectors (6)
SKU Description Size Price
RC211275 SLURP1 (Myc-DDK-tagged)-Human secreted LY6/PLAUR domain containing 1 (SLURP1) 10 ug
$225.00
RC211275L1 Lenti ORF clone of Human secreted LY6/PLAUR domain containing 1 (SLURP1), Myc-DDK-tagged 10 ug
$525.00
RC211275L2 Lenti ORF clone of Human secreted LY6/PLAUR domain containing 1 (SLURP1), mGFP tagged 10 ug
$525.00
RC211275L3 Lenti ORF clone of Human secreted LY6/PLAUR domain containing 1 (SLURP1), Myc-DDK-tagged 10 ug
$525.00
RC211275L4 Lenti ORF clone of Human secreted LY6/PLAUR domain containing 1 (SLURP1), mGFP tagged 10 ug
$525.00
RG211275 SLURP1 (tGFP-tagged) - Human secreted LY6/PLAUR domain containing 1 (SLURP1) 10 ug
$425.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products