OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

COLEC10 (NM_006438) Human Untagged Clone

Be the first to review this product
SKU
SC303774
COLEC10 (untagged)-Human collectin sub-family member 10 (C-type lectin) (COLEC10)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA333920 Rabbit Polyclonal Anti-COLEC10 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "COLEC10 or NM_006438"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol COLEC10
Synonyms 3MC3; CL-10; CL-34; CLL1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_006438 edited
TTTGGCATTTCTGGGAGACCCTTTTCTGAGGAACCACAGCAATGAATGGCTTTGCATCCT
TGCTTCGAAGAAACCAATTTATCCTCCTGGTACTATTTCTTTTGCAAATTCAGAGTCTGG
GTCTGGATATTGATAGCCGTCCTACCGCTGAAGTCTGTGCCACACACACAATTTCACCAG
GACCCAAAGGAGATGATGGTGAAAAAGGAGATCCAGGAGAAGAGGGAAAGCATGGCAAAG
TGGGACGCATGGGGCCGAAAGGAATTAAAGGAGAACTGGGTGATATGGGAGATCAGGGCA
ATATTGGCAAGACTGGGCCCATTGGGAAGAAGGGTGACAAAGGGGAAAAAGGTTTGCTTG
GAATACCTGGAGAAAAAGGCAAAGCAGGTACTGTCTGTGATTGTGGAAGATACCGGAAAT
TTGTTGGACAACTGGATATTAGTATTGCTCGGCTCAAGACATCTATGAAGTTTGTCAAGA
ATGTGATAGCAGGGATTAGGGAAACTGAAGAGAAATTCTACTACATCGTGCAGGAAGAGA
AGAACTACAGGGAATCCCTAACCCACTGCAGGATTCGGGGTGGAATGCTAGCCATGCCCA
AGGATGAAGCTGCCAACACACTCATCGCTGACTATGTTGCCAAGAGTGGCTTCTTTCGGG
TGTTCATTGGCGTGAATGACCTTGAAAGGGAGGGACAGTACATGTTCACAGACAACACTC
CACTGCAGAACTATAGCAACTGGAATGAGGGGGAACCCAGCGACCCCTATGGTCATGAGG
ACTGTGTGGAGATGCTGAGCTCTGGCAGATGGAATGACACAGAGTGCCATCTTACCATGT
ACTTTGTCTGTGAGTTCATCAAGAAGAAAAAGTAACTTCCCTCATCCTACGTATTTGCTA
TTTTCCTGTGACCGTCATTACAGTTATTGTTATCCATCCTTTTTTTCCTGATTGTACTAC
ATTTGATCTGAGTCAACATAGCTAGAAAATGCTAAACTGAGGTATGGAGCCTCCATCATC
ATGCTCTTTTGTGATGATTTTCATATTTTCACACATGGTATATTATTGACCCAATAACTC
GCCAGGTTACATGGGTCTTGAGAGAGAATTTTAATTACTAATTGTGCACGAGATAGTTGG
TTGTCTATATGTCAAATGAGTTGTTCTCTTGGTATTTGCTCTACCATCTCTCCCTAGAGC
ACTCTGTGTCTATCCCAGTGGATAATTTCCCAGTTTACTGGTGATGATTAGGAAGGTTGT
TGATGG
Restriction Sites Please inquire |
ACCN NM_006438
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_006438.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006438.2, NP_006429.1
RefSeq Size 1686 bp
RefSeq ORF 834 bp
Locus ID 10584
UniProt ID Q9Y6Z7
Cytogenetics 8q24.12
Summary This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. The other members of this family are secreted proteins and bind to carbohydrate antigens on microorganisms facilitating their recognition and removal. This gene product is a cytosolic protein, a characteristic that suggests that it may have different biological functions than other C-lectins. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_006438" in other vectors (6)
SKU Description Size Price
RC220039 COLEC10 (Myc-DDK-tagged)-Human collectin sub-family member 10 (C-type lectin) (COLEC10) 10 ug
$300.00
RC220039L1 Lenti ORF clone of Human collectin sub-family member 10 (C-type lectin) (COLEC10), Myc-DDK-tagged 10 ug
$600.00
RC220039L2 Lenti ORF clone of Human collectin sub-family member 10 (C-type lectin) (COLEC10), mGFP tagged 10 ug
$600.00
RC220039L3 Lenti ORF clone of Human collectin sub-family member 10 (C-type lectin) (COLEC10), Myc-DDK-tagged 10 ug
$600.00
RC220039L4 Lenti ORF clone of Human collectin sub-family member 10 (C-type lectin) (COLEC10), mGFP tagged 10 ug
$600.00
RG220039 COLEC10 (tGFP-tagged) - Human collectin sub-family member 10 (C-type lectin) (COLEC10) 10 ug
$489.00 $500.00

file-alt Citations

A novel COLEC10 mutation in a child with 3MC syndrome
Migliorero, Kalantari, Bracciamà et al
European Journal of Medical Genetics (2021) 64 (12), 104374 DOI: 10.1016/j.ejmg.2021.104374
Cited by 8
AI Summary: OriGene’s pCMV6-XL5-COLEC10 plasmid (catalog number SC303774) was used to introduce and study the COLEC10 mutation’s effects on protein function in this research on 3MC syndrome.
Snippet: … They are characterized by a variable spectrum of abnormalities, including facial , with Save;The c.807_810delCTGT genetic variant was introduced into a plasmid encoding wild-type human CL-L1 (pCMV6-XL5-COLEC10;SC303774, Origene, Rockville, US)
COLEC10 is mutated in 3MC patients and regulates early craniofacial development
Munye, Diaz-Font, Ocaka et al
PLoS Genet. (2017) 13 (3), e1006679 DOI: 10.1371/journal.pgen.1006679
AI Summary: OriGene's pCMV6-XL5-COLEC10 plasmid (SC303774) was used to study the effects of COLEC10 mutations on protein expression and secretion in 3MC syndrome research.
Snippet: Cys176Trp were introduced into a plasmid encoding wild-type human CL-L1 (pCMV6-XL5-COLEC10;OriGene, SC303774) using QuickChange II Site-Directed Mutagenesis kit (Agilent) with hCOLEC10Arg9Ter,
Investigations on collectin liver 1
Axelgaard, Jensen, Dyrlund et al
J. Biol. Chem. (2013) 288 (32), 23407-20 DOI: 10.1074/jbc.M113.492603
AI Summary: OriGene’s pCMV6XL4 transcription vector was used to express recombinant human CL-L1 in HEK293F cells, enabling the study of CL-L1’s structure and function in this research.
Snippet: Expression of Recombinant CL-L1 in HEK293F Cells. A cDNA clone (DNA Technology A/S, Denmark) encoding the full-length cDNA of human CL-L1 was introduced into the pCMV6XL4 transcription vector (OriGene, Technologies, Rockville, MD).
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products