OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SPRR1A (NM_005987) Human Untagged Clone

Be the first to review this product
SKU
SC303714
SPRR1A (untagged)-Human small proline-rich protein 1A (SPRR1A), transcript variant 2
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA381960 SPRR1A Rabbit polyclonal Antibody
100 ul
$410.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SPRR1A or NM_005987"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SPRR1A
Synonyms SPRK
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_005987 edited
CCAAGGGACCACACAGCCCATTCTGCTCCGTATACCAGAAAAAAACACATTTGAAGCATG
AATTCTCAGCAGCAGAAGCAGCCTTGCACCCCACCCCCTCAGCCTCAGCAGCAGCAGGTG
AAACAACCTTGCCAGCCTCCACCCCAGGAACCATGCATCCCCAAAACCAAGGAGCCCTGC
CAACCCAAGGTGCCTGAGCCCTGCCACCCCAAAGTGCCTGAGCCCTGCCAGCCCAAGATT
CCAGAGCCCTGCCAGCCCAAGGTGCCTGAGCCCTGCCCTTCAACGGTCACTCCAGCACCA
GCCCAGCAGAAGACCAAGCAGAAGTAATGTGGTCCACAGCCATGCCCTTGAGGAGCTGGC
C
Restriction Sites Please inquire |
ACCN NM_005987
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to differ from the protein associated to this reference by two amino acids.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005987.2, NP_005978.2
RefSeq Size 664 bp
RefSeq ORF 270 bp
Locus ID 6698
UniProt ID P35321
Cytogenetics 1q21.3
Summary Cross-linked envelope protein of keratinocytes. It is a keratinocyte protein that first appears in the cell cytosol, but ultimately becomes cross-linked to membrane proteins by transglutaminase. All that results in the formation of an insoluble envelope beneath the plasma membrane.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) has an alternate splice site, resulting in a shorter 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_005987" in other vectors (6)
SKU Description Size Price
RC211258 SPRR1A (Myc-DDK-tagged)-Human small proline-rich protein 1A (SPRR1A), transcript variant 2 10 ug
$150.00
RC211258L1 Lenti ORF clone of Human small proline-rich protein 1A (SPRR1A), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC211258L2 Lenti ORF clone of Human small proline-rich protein 1A (SPRR1A), transcript variant 2, mGFP tagged 10 ug
$450.00
RC211258L3 Lenti ORF clone of Human small proline-rich protein 1A (SPRR1A), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC211258L4 Lenti ORF clone of Human small proline-rich protein 1A (SPRR1A), transcript variant 2, mGFP tagged 10 ug
$450.00
RG211258 SPRR1A (tGFP-tagged) - Human small proline-rich protein 1A (SPRR1A), transcript variant 2 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products