OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TSPY1 (NM_003308) Human Untagged Clone

Be the first to review this product
SKU
SC303293
TSPY1 (untagged)-Human testis specific protein, Y-linked 1 (TSPY1), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA351868 Rabbit Polyclonal Anti-TSPY1/TSPY3 Antibody
100 ul
$205.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TSPY1 or NM_003308"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TSPY1
Synonyms CT78; DYS14; pJA923; TSPY
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003308 edited
AACAGGCCCTTCGCGCGCAGTCCCTTAGGGGGCGCCTGGAAGCCCGGCGCATGCGCCCTG
AGGGCTCGCTGACCTACCGGGTGCCAGAGAGGCTGCGGCAGGGTTTCTGTGGCGTGGGTC
GGGCAGCACAGGCCTTGGTGTGTGCGAGTGCCAAGGAGGGCACCGCCTTCAGGATGGAGG
CTGTACAGGAGGGGGCGGCCGGGGTGGAGAGTGAGCAGGCGGCTTTGGGGGAGGAGGCGG
TGCTGCTGTTGGATGACATAATGGCGGAGGTGGAGGTGGTGGCGGAGGAGGAGGGCCTCG
TGGAGCGGCGGGAGGAGGCCCAGCGGGCACAGCAGGCTGTGCCTGGCCCTGGGCCCATGA
CCCCAGAGTCTGCACTGGAGGAGCTGCTGGCCGTTCAGGTGGAGCTGGAGCCGGTTAATG
CCCAAGCCAGGAAGGCCTTTTCTCGGCAGCGGGAAAAGATGGAGCGGAGGCGCAAGCCCC
ACCTAGACCGCAGAGGCGCCGTCATCCAGAGCGTCCCTGGCTTCTGGGCCAATGTTATTG
CAAACCACCCCCAGATGTCAGCCCTGATCACTGACGAAGATGAAGACATGCTGAGCTACA
TGGTCAGCCTGGAGGTGGRAGAAGAGAAGCATCCTGTTCATCTCTGCAAGATCATGTTGT
TCTTTCGGAGTAACCCCTACTTCCAGAATAAAGTGATTACCAAGGAATATCTGGTGAACA
TCACAGAATACAGGGCTTCTCATTCCACTCCAATTGAGTGGTATCCGGATTATGAAGTGG
AGGCCTATCGCCGCAGACACCACAACAGCAGCCTTAACTTCTTCAACTGGTTCTCTGACC
ACAACTTCGCAGGATCTAACAAGATTGCTGAGATCCTATGTAAGGACCTGTGGCGCAATC
CCCTGCAATACTACAAGAGGATGAAGCCACCTGAAGAGGGAACAGAGACRTCAGGGGACT
CCCAGTTGTTGAGTTGAATATGATGGAGCATCAGATTTTACCTAATACAGCAGAACTCCT
AAAAAGTTACAGCCATATGCAGGA
Restriction Sites Please inquire |
ACCN NM_003308
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003308.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003308.2, NP_003299.1
RefSeq Size 1159 bp
RefSeq ORF 927 bp
Locus ID 7258
UniProt ID Q01534
Cytogenetics Yp11.2
Summary The protein encoded by this gene is found only in testicular tissue and may be involved in spermatogenesis. Many functional paralogs and pseudogenes of this gene are present in a cluster in humans, but only a single, nonfunctional orthologous gene is found in mouse. Alternative splicing results in multiple transcript variants. provided by RefSeq, Mar 2016
Transcript Variant: This variant (1) encodes the longer isoform (TSPY-S). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_003308" in other vectors (4)
SKU Description Size Price
RC222747 TSPY1 (Myc-DDK-tagged)-Human testis specific protein, Y-linked 1 (TSPY1), transcript variant 1 10 ug
$289.00 $300.00
RC222747L3 Lenti-ORF clone of TSPY1 (Myc-DDK-tagged)-Human testis specific protein, Y-linked 1 (TSPY1), transcript variant 1 10 ug
$600.00
RC222747L4 Lenti-ORF clone of TSPY1 (mGFP-tagged)-Human testis specific protein, Y-linked 1 (TSPY1), transcript variant 1 10 ug
$600.00
RG222747 TSPY1 (tGFP-tagged) - Human testis specific protein, Y-linked 1 (TSPY1), transcript variant 1 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products