OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

LIN28B (NM_001004317) Human Untagged Clone

Be the first to review this product
SKU
SC300636
LIN28B (untagged)-Human lin-28 homolog B (C. elegans) (LIN28B)
  $450.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA324574 LIN28B Antibody (N-term)
400 ul
$645.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "LIN28B or NM_001004317"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LIN28B
Synonyms CSDD2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001004317 edited
ATGGCCGAAGGCGGGGCTAGCAAAGGTGGTGGAGAAGAGCCCGGGAAGCTGCCGGAGCCG
GCAGAGGAGGAATCCCAGGTTTTGCGCGGAACTGGCCACTGTAAGTGGTTCAATGTGCGC
ATGGGATTTGGATTCATCTCCATGATAAACCGAGAGGGAAGCCCCTTGGATATTCCAGTC
GATGTATTTGTACACCAAAGCAAACTATTCATGGAAGGATTTAGAAGCCTAAAAGAAGGA
GAACCAGTGGAATTCACATTTAAAAAATCTTCCAAAGGCCTTGAGTCAATACGGGTAACA
GGACCTGGTGGGAGCCCCTGTTTAGGAAGTGAAAGAAGACCCAAAGGGAAGACACTACAG
AAAAGAAAACCAAAGGGAGATAGATGCTACAACTGTGGTGGCCTTGATCATCATGCTAAG
GAATGTAGTCTACCTCCTCAGCCAAAGAAGTGCCATTACTGTCAGAGCATCATGCACATG
GTGGCAAACTGCCCACATAAAAATGTTGCACAGCCACCCGCGAGTTCTCAGGGAAGACAG
GAAGCAGAATCCCAGCCATGCACTTCAACTCTCCCTCGAGAAGTGGGAGGCGGGCATGGC
TGTACATCACCACCGTTTCCTCAGGAGGCTAGGGCAGAGATCTCAGAACGGTCAGGCAGG
TCACCTCAAGAAGCTTCCTCCACGAAGTCATCTATAGCACCAGAAGAGCAAAGCAAAAAG
GGGCCTTCAGTTCAAAAAAGGAAAAAGACATAA
Restriction Sites Please inquire |
ACCN NM_001004317
Insert Size 2900 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001004317.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001004317.2, NP_001004317.1
RefSeq Size 5504 bp
RefSeq ORF 753 bp
Locus ID 389421
UniProt ID Q6ZN17
Cytogenetics 6q16.3-q21
Summary The protein encoded by this gene belongs to the lin-28 family, which is characterized by the presence of a cold-shock domain and a pair of CCHC zinc finger domains. This gene is highly expressed in testis, fetal liver, placenta, and in primary human tumors and cancer cell lines. It is negatively regulated by microRNAs that target sites in the 3' UTR, and overexpression of this gene in primary tumors is linked to the repression of let-7 family of microRNAs and derepression of let-7 targets, which facilitates cellular transformation. provided by RefSeq, Jun 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001004317" in other vectors (6)
SKU Description Size Price
RC213537 LIN28B (Myc-DDK-tagged)-Human lin-28 homolog B (C. elegans) (LIN28B) 10 ug
$450.00
RC213537L1 Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), Myc-DDK-tagged 10 ug
$750.00
RC213537L2 Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), mGFP tagged 10 ug
$750.00
RC213537L3 Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), Myc-DDK-tagged 10 ug
$750.00
RC213537L4 Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), mGFP tagged 10 ug
$750.00
RG213537 LIN28B (tGFP-tagged) - Human lin-28 homolog B (C. elegans) (LIN28B) 10 ug
$650.00

file-alt Citations

Structural insights of the pre-let-7 interaction with LIN28B
Rangel-Guerrero, Franco-Urquijo, Martínez-Salas et al
Nucleosides Nucleotides Nucleic Acids (2020)
Cited by 6
AI Summary: OriGene’s human LIN28B cDNA (Cat# RC222730) was used in this study to express LIN28B protein for investigating its structural interactions with pre-let-7 RNAs.
Snippet: 2. Materials and methods. 2.1. Oligonucleotides and plasmids. All oligonucleotides were purchased from T4 oligo (ADN Sintetico SAPI de CV, Gto., Mexico), unless otherwise stated ( Supplementary Table 1 ). Human LIN28B cDNA (OriGene, No
Sirtuin 6 inhibits colon cancer progression by modulating PTEN/AKT signaling
Tian, Yuan
Biomed. Pharmacother. (2018) 106, 109-116 DOI: 10.1016/j.biopha.2018.06.070
AI Summary: OriGene’s human PTEN shRNA (No. SC300636) was used in this study to specifically knock down PTEN expression, enabling the authors to investigate the role of PTEN in SIRT6-mediated inhibition of colon cancer progression.
Snippet: Short hairpin RNA (shRNA) targeting human PTEN gene (No. SC300636) used to down-regulate PTEN expression and their controls were all purchased from OriGene (MA, USA). The knockdown efficiency was detected by Western blotting. 2.5
LIN28B promotes the progression of colon cancer by increasing B-cell lymphoma 2 expression
Yuan, Tian
Biomed. Pharmacother. (2018) 103, 355-361 DOI: 10.1016/j.biopha.2018.04.002
AI Summary: OriGene products, including human LIN28B plasmid (SC300636), mouse LIN28B plasmid (MC214667), human BCL-2 siRNA (SR300411), and mouse BCL-2 siRNA (SR405079), were used to manipulate LIN28B and BCL-2 expression levels, enabling the study of their roles in colon cancer progression.
Snippet: The plasmids of the human LIN28B gene (No. SC300636) or mouse LIN28B gene (No. MC214667), small interfering RNAs targeting human BCL-2 (No. SR300411) or mouse BCL-2 (No. SR405079), and their controls were purchased from OriGene (MA, USA)
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products