OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

RS1 (NM_000330) Human Untagged Clone

Be the first to review this product
SKU
SC300046
RS1 (untagged)-Human retinoschisin 1 (RS1)
  $450.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "RS1 or NM_000330"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RS1
Synonyms RS; XLRS1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_000330 edited
ATGTCACGCAAGATAGAAGGCTTTTTGTTATTACTTCTCTTTGGCTATGAAGCCACATTG
GGATTATCGTCTACCGAGGATGAAGGCGAGGACCCCTGGTACCAAAAAGCATGCAAGTGC
GATTGCCAAGGAGGACCCAATGCTCTGTGGTCTGCAGGTGCCACCTCCTTGGACTGTATA
CCAGAATGCCCATATCACAAGCCTCTGGGTTTCGAGTCAGGGGAGGTCACACCGGACCAG
ATCACCTGCTCTAACCCGGAGCAGTATGTGGGCTGGTATTCTTCGTGGACTGCAAACAAG
GCCCGGCTCAACAGTCAAGGCTTTGGGTGTGCCTGGCTCTCCAAGTTCCAGGACAGTAGC
CAGTGGTTACAGATAGATCTGAAGGAGATCAAAGTGATTTCAGGGATCCTCACCCAGGGG
CGCTGTGACATCGATGAGTGGATGACCAAGTACAGCGTGCAGTACAGGACCGATGAGCGC
CTGAACTGGATTTACTACAAGGACCAGACTGGAAACAACCGGGTCTTCTATGGCAACTCG
GACCGCACCTCCACGGTTCAGAACCTGCTGCGGCCCCCCATCATCTCCCGCTTCATCCGC
CTCATCCCGCTGGGCTGGCACGTCCGCATTGCCATCCGGATGGAGCTGCTGGAGTGCGTC
AGCAAGTGTGCCTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000330 unedited
NACGTCCACAAATTTGTAATACGACTCACTATAGGGCGGCCGCGNATTCATGTCACGCAA
GATAGAAGGCTTTTTGTTATTACTTCTCTTTGGCTATGAAGCCACATTGGGATTATCGTC
TACCGAGGATGAAGGCGAGGACCCCTGGTACCAAAAAGCATGCAAGTGCGATTGCCAAGG
AGGACCCAATGCTCTGTGGTCTGCAGGTGCCACCTCCTTGGACTGTATACCAGAATGCCC
ATATCACAAGCCTCTGGGTTTCGAGTCAGGGGAGGTCACACCGGACCAGATCACCTGCTC
TAACCCGGAGCAGTATGTGGGCTGGTATTCTTCGTGGACTGCAAACAAGGCCCGGCTCAA
CAGTCAAGGCTTTGGGTGTGCCTGGCTCTCCAAGTTCCAGGACAGTAGCCAGTGGTTACA
GATAGATCTGAAGGAGATCAAAGTGATTTCAGGGATCCTCACCCAGGGGCGCTGTGACAT
CGATGAGTGGATGACCAAGTACAGCGTGCAGTACAGGACCGATGAGCGCCTGAACTGGAT
TTACTACAAGGACCAGACTGGAAACAACCGGGTCTTCTATGGCAACTCGGACCGCACCTC
CACGGTTCAGAACCTGCTGCGGCCCCCCATCATCTCCCGCTTCATCCGCCTCATCCCGCT
GGGCTGGCACGTCCGCATTGCCATCCGGATGGAGCTGCTGGAGTGCGTCAGCAAGTGTGC
CTGACTCGACTCTAGATTGCNNGCCGCGTCATAGCTGTTTCCTGAACAGATCCCCGGTGG
CATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCC
ACAGCCTTGTTCTAATAAATAAANTGCATCATTTGTCTGATAGGTGTCCTCTATATATAT
GGGGTGGAGGGGGG
Restriction Sites Please inquire |
ACCN NM_000330
Insert Size 700 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000330.2, NP_000321.1
RefSeq Size 3046 bp
RefSeq ORF 675 bp
Locus ID 6247
UniProt ID O15537
Cytogenetics Xp22.13
Protein Families Secreted Protein
Summary This gene encodes an extracellular protein that plays a crucial role in the cellular organization of the retina. The encoded protein is assembled and secreted from photoreceptors and bipolar cells as a homo-oligomeric protein complex. Mutations in this gene are responsible for X-linked retinoschisis, a common, early-onset macular degeneration in males that results in a splitting of the inner layers of the retina and severe loss in vision. provided by RefSeq, Oct 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_000330" in other vectors (6)
SKU Description Size Price
RC214267 RS1 (Myc-DDK-tagged)-Human retinoschisin 1 (RS1) 10 ug
$450.00
RC214267L1 Lenti ORF clone of Human retinoschisin 1 (RS1), Myc-DDK-tagged 10 ug
$750.00
RC214267L2 Lenti ORF clone of Human retinoschisin 1 (RS1), mGFP tagged 10 ug
$750.00
RC214267L3 Lenti ORF clone of Human retinoschisin 1 (RS1), Myc-DDK-tagged 10 ug
$750.00
RC214267L4 Lenti ORF clone of Human retinoschisin 1 (RS1), mGFP tagged 10 ug
$750.00
RG214267 RS1 (tGFP-tagged) - Human retinoschisin 1 (RS1) 10 ug
$650.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products