OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Heme Oxygenase 1 (HMOX1) (NM_002133) Human Untagged Clone

Be the first to review this product
SKU
SC128080
HMOX1 (untagged)-Human heme oxygenase (decycling) 1 (HMOX1)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA348005 Rabbit Polyclonal Anti-HO-1 Antibody
100 ug
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Heme Oxygenase 1 or NM_002133"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Heme Oxygenase 1
Synonyms bK286B10; HMOX1D; HO-1; HSP32
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC128080 sequence for NM_002133 edited (data generated by NextGen Sequencing)
ATGGAGCGTCCGCAACCCGACAGCATGCCCCAGGATTTGTCAGAGGCCCTGAAGGAGGCC
ACCAAGGAGGTGCACACCCAGGCAGAGAATGCTGAGTTCATGAGGAACTTTCAGAAGGGC
CAGGTGACCCGAGACGGCTTCAAGCTGGTGATGGCCTCCCTGTACCACATCTATGTGGCC
CTGGAGGAGGAGATTGAGCGCAACAAGGAGAGCCCAGTCTTCGCCCCTGTCTACTTCCCA
GAAGAGCTGCACCGCAAGGCTGCCCTGGAGCAGGACCTGGCCTTCTGGTACGGGCCCCGC
TGGCAGGAGGTCATCCCCTACACACCAGCCATGCAGCGCTATGTGAAGCGGCTCCACGAG
GTGGGGCGCACAGAGCCCGAGCTGCTGGTGGCCCACGCCTACACCCGCTACCTGGGTGAC
CTGTCTGGGGGCCAGGTGCTCAAAAAGATTGCCCAGAAAGCCCTGGACCTGCCCAGCTCT
GGCGAGGGCCTGGCCTTCTTCACCTTCCCCAACATTGCCAGTGCCACCAAGTTCAAGCAG
CTCTACCGCTCCCGCATGAACTCCCTGGAGATGACTCCCGCAGTCAGGCAGAGGGTGATA
GAAGAGGCCAAGACTGCGTTCCTGCTCAACATCCAGCTCTTTGAGGAGTTGCAGGAGCTG
CTGACCCATGACACCAAGGACCAGAGCCCCTCACGGGCACCAGGGCTTCGCCAGCGGGCC
AGCAACAAAGTGCAAGATTCTGCCCCCGTGGAGACTCCCAGAGGGAAGCCCCCACTCAAC
ACCCGCTCCCAGGCTCCGCTTCTCCGATGGGTCCTTACACTCAGCTTTCTGGTGGCGACA
GTTGCTGTAGGGCTTTATGCCATGTGA

Clone variation with respect to NM_002133.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002133 unedited
GCACGAGCCTCCTCTCGAGCGTCCTCAGCGCAGCCGCCGCCCGCGGAGCCAGCACGAACG
AGCCCAGCACCGGCCGGATGGAGCGTCCGCAACCCGACAGCATGCCCCAGGATTTGTCAG
AGGCCCTGAAGGAGGCCACCAAGGAGGTGCACACCCAGGCAGAGAAATGCTGAGTTCATG
AGGAACTTTCAGAAGGGCCAGGTGACCCGAGACGGCTTCAAGCTGGTGATGGCCTTCCTG
GACCACATCTATGTGGCCCTGGAGGAGGAGATTGAGCGCAACAAGGAGAGCCCAGTCTTC
GCCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002133 unedited
NNGGGTAAGACTAGGACCCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTA
CTATCAGACAATGTTGTTTATTATTTCACACAAAAGTTAGACCAAGGCCACAGTGCCGTT
AAACACCTCCCTCCCCACCCACGCATGGCTCAAAAACCACCCCAACCCTGCTATAAAAAC
AACAGAACACAACAAAAATACTGCATTTGAGGCTGAGCCAGGAACAGAGTGGCTCCAACA
AAAATAAGACAAAAACACAAGACACAACATCTTTTCAGGTTTGTGTAAAAATTGCCATGG
CCCACGGGGAAAGTGGTCATGGCCGTGTCAACAAGGATACTTGAAACTCAGGGCTTTTGG
AGGTTTGAGACAGCTGCCACATTAGGGTGTCTTCCAGGCTCTGCTGCAGGAACTGAGGAT
GCTGAAGGGCAGGGCTGATCCCTTCGCCCCCTCTGAAGTTTAGGCCATTGCCTGGATGTG
CTTTTCGTTGGGGAAGATGCCATAGGCTCCTTCCTCCTTTCCAGAGAGAGGGACACAGTG
AGAGGGCTGGAGGCCCTGAAAGCCTTCAGTGCCCACGGTAAGGAAGCCAGCCAAGAGAAT
TCCCTCTCTAGAAAGAAGGCCTTCCACCGGACAAAGTTCATGGCCCTGGGAGCCAGCATG
CCTGCATTCACATGGCATANAGCCCTACAGCAACTGTCGCCACCAGAAAGCTGAGTGTAA
GGACCCATNCGAGAAGCGGAGCCTGGGAGCGGGTGTTGAGTGGGGGCTTCCCTCTGGGAG
TCTCCACGGGGCAGAAATCTGCACTTTGNTGCTGGCCCGCTGGCGAAGCCCTGGNTGCCG
TGAGGNGCTCTGGTCCCTGGTGTCATGGGTCAGCAGCTCCTGGAACTTCTCAAAGAGCTG
GATG
Restriction Sites NotI-NotI |
ACCN NM_002133
Insert Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002133.1, NP_002124.1
RefSeq Size 1550 bp
RefSeq ORF 867 bp
Locus ID 3162
UniProt ID P09601
Cytogenetics 22q12.3
Domains Heme_oxygenase
Protein Families Druggable Genome, Transmembrane
Protein Pathways Porphyrin and chlorophyll metabolism
Summary Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002133" in other vectors (7)
SKU Description Size Price
RC200463 HMOX1 (Myc-DDK-tagged)-Human heme oxygenase (decycling) 1 (HMOX1) 10 ug
$300.00
RC200463L1 Lenti ORF clone of Human heme oxygenase (decycling) 1 (HMOX1), Myc-DDK-tagged 10 ug
$600.00
RC200463L2 Lenti ORF clone of Human heme oxygenase (decycling) 1 (HMOX1), mGFP tagged 10 ug
$600.00
RC200463L3 Lenti ORF clone of Human heme oxygenase (decycling) 1 (HMOX1), Myc-DDK-tagged 10 ug
$600.00
RC200463L4 Lenti ORF clone of Human heme oxygenase (decycling) 1 (HMOX1), mGFP tagged 10 ug
$600.00
RG200463 HMOX1 (tGFP-tagged) - Human heme oxygenase (decycling) 1 (HMOX1) 10 ug
$489.00 $500.00
SC320297 HMOX1 (untagged)-Human heme oxygenase (decycling) 1 (HMOX1) 10 ug
$300.00

file-alt Citations

Heme oxygenase-1 mediates BAY 11-7085 induced ferroptosis
Chang, Chiang, Chen et al
Cancer Lett. (2017) 416, 124-137 DOI: 10.1016/j.canlet.2017.12.025
AI Summary: OriGene products contributed to this study by providing the pCMV-XL5 empty vector and the human HMOX1 cDNA vector, which were used for transfection experiments to investigate the role of HO-1 in BAY 11-7085-induced ferroptosis.
Snippet: The empty vector, pCMV-XL5 (OriGene) or pcDNA3.1 + /C-(K)DYK (GeneScript), or the vector containing human HMOX1 cDNA (OriGene) or human SLC7A11 (GeneScript) were transfected into cells for 24 h. 2.12. Isolation of cytosolic and nuclear protein
Carbon Monoxide Induces Heme Oxygenase-1 to Modulate STAT3 Activation in Endothelial Cells via S-Glutathionylation
Yang, Huang, Hsieh et al
PLoS ONE (2014) 9 (7), e100677 DOI: 10.1371/journal.pone.0100677
Cited by 35
AI Summary: In this study, the Homo sapiens heme oxygenase-1 expression vector (HMOX1) from OriGene was used to investigate the role of HO-1 in modulating STAT3 activation and protein glutathionylation in endothelial cells.
Snippet: activation. Materials and Methods. Materials. Bacterially derived IL-6 was purchased from Calbiochem (San Diego, CA). Homo sapiens heme oxygenase-1 expression vector (HMOX1) was obtained from OriGene (Rockville, MD). ... Cite SaveSaving
The flavonoid, eriodictyol, induces long-term protection in ARPE-19 cells through its effects on Nrf2 activation and phase 2 gene expression
Johnson, Maher, Hanneken
Invest Ophthalmol Vis Sci (2009) 50 (5), 2398-406 DOI: 10.1167/iovs.08-2088
Cited by 118
AI Summary: OriGene products contributed to this study by providing shRNA specific for HO-1 (OriGene), which was used to investigate the role of HO-1 in eriodictyol-induced protection of ARPE-19 cells against oxidative stress.
FigureFigure
The combined effects of physicochemical properties of size-fractionated ambient particulate matter on in vitro toxicity in human A549 lung epithelial cells
Akhtar, Rastogi, McWhinney et al
Toxicology Reports (2014) 1, 145–156
Snippet: respectively. Plasmids and primers for HMOX-1 and IL-8 were obtained from OriGene (Rockville, MD, USA) and Integrated DNA Technologies Inc. (Coralville, IA, USA), respectively. 2.3. Cell culture and particle exposure. A549 ... Cite SaveSaving
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products