OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CD19 (NM_001770) Human Untagged Clone

Be the first to review this product
SKU
SC127938
CD19 (untagged)-Human CD19 molecule (CD19), transcript variant 2
  $519.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA506236 CD19 mouse monoclonal antibody, clone OTI3B10 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CD19 or NM_001770"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CD19
Synonyms B4; CVID3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001770 edited
AGGCCCCTGCCTGCCCCAGCATCCCCTGCGCGAAGCTGGGTGCCCCGGAGAGTCTGACCA
CCATGCCACCTCCTCGCCTCCTCTTCTTCCTCCTCTTCCTCACCCCCATGGAAGTCAGGC
CCGAGGAACCTCTAGTGGTGAAGGTGGAAGAGGGAGATAACGCTGTGCTGCAGTGCCTCA
AGGGGACCTCAGATGGCCCCACTCAGCAGCTGACCTGGTCTCGGGAGTCCCCGCTTAAAC
CCTTCTTAAAACTCAGCCTGGGGCTGCCAGGCCTGGGAATCCACATGAGGCCCCTGGCCA
TCTGGCTTTTCATCTTCAACGTCTCTCAACAGATGGGGGGCTTCTACCTGTGCCAGCCGG
GGCCCCCCTCTGAGAAGGCCTGGCAGCCTGGCTGGACAGTCAATGTGGAGGGCAGCGGGG
AGCTGTTCCGGTGGAATGTTTCGGACCTAGGTGGCCTGGGCTGTGGCCTGAAGAACAGGT
CCTCAGAGGGCCCCAGCTCCCCTTCCGGGAAGCTCATGAGCCCCAAGCTGTATGTGTGGG
CCAAAGACCGCCCTGAGATCTGGGAGGGAGAGCCTCCGTGTCTCCCACCGAGGGACAGCC
TGAACCAGAGCCTCAGCCAGGACCTCACCATGGCCCCTGGCTCCACACTCTGGCTGTCCT
GTGGGGTACCCCCTGACTCTGTGTCCAGGGGCCCCCTCTCCTGGACCCATGTGCACCCCA
AGGGGCCTAAGTCATTGCTGAGCCTAGAGCTGAAGGACGATCGCCCGGCCAGAGATATGT
GGGTAATGGAGACGGGTCTGTTGTTGCCCCGGGCCACAGCTCAAGACGCTGGAAAGTATT
ATTGTCACCGTGGCAACCTGACCATGTCATTCCACCTGGAGATCACTGCTCGGCCAGTAC
TATGGCACTGGCTGCTGAGGACTGGTGGCTGGAAGGTCTCAGCTGTGACTTTGGCTTATC
TGATCTTCTGCCTGTGTTCCCTTGTGGGCATTCTTCATCTTCAAAGAGCCCTGGTCCTGA
GGAGGAAAAGAAAGCGAATGACTGACCCCACCAGGAGATTCTTCAAAGTGACGCCTCCCC
CAGGAAGCGGGCCCCAGAACCAGTACGGGAACGTGCTGTCTCTCCCCACACCCACCTCAG
GCCTCGGACGCGCCCAGCGTTGGGCCGCAGGCCTGGGGGGCACTGCCCCGTCTTATGGAA
ACCCGAGCAGCGACGTCCAGGCGGATGGAGCCTTGGGGTCCCGGAGCCCGCCGGGAGTGG
GCCCAGAAGAAGAGGAAGGGGAGGGCTATGAGGAACCTGACAGTGAGGAGGACTCCGAGT
TCTATGAGAACGACTCCAACCTTGGGCAGGACCAGCTCTCCCAGGATGGCAGCGGCTACG
AGAACCCTGAGGATGAGCCCCTGGGTCCTGAGGATGAAGACTCCTTCTCCAACGCTGAGT
CTTATGAGAACGAGGATGAAGAGCTGACCCAGCCGGTCGCCAGGACAATGGACTTCCTGA
GCCCTCATGGGTCAGCCTGGGACCCCAGCCGGGAAGCAACCTCCCTGGGGTCCCAGTCCT
ATGAGGATATGAGAGGAATCCTGTATGCAGCCCCCCAGCTCCGCTCCATTCGGGGCCAGC
CTGGACCCAATCATGAGGAAGATGCAGACTCTTATGAGAACATGGATAATCCCGATGGGC
CAGACCCAGCCTGGGGAGGAGGGGGCCGCATGGGCACCTGGAGCACCAGGTGATCCTCAG
GTGGCCAGCCTGGATCTCCTCAAGTCCCCAAGATTCACACCTGACTCTGAAATCTGAAGA
CCTCGAGCAGATGATGCCAACCTCTGGAGCAATGTTGCTTAGGATGTGTGCATGTGTGTA
AGTGTGTGTGTGTGTGTGTGTGTGTATACATGCCAGTGACACTTCCAGTCCCCTTTGTAT
TCCTTAAATAAACTCAATGAGCTCTTCCA
Restriction Sites Please inquire |
ACCN NM_001770
Insert Size 1671 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation no
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001770.3, NP_001761.2
RefSeq Size 1932 bp
RefSeq ORF 1671 bp
Locus ID 930
UniProt ID P15391
Cytogenetics 16p11.2
Protein Families Druggable Genome, Transmembrane
Protein Pathways B cell receptor signaling pathway, Hematopoietic cell lineage, Primary immunodeficiency
Summary This gene encodes a member of the immunoglobulin gene superfamily. Expression of this cell surface protein is restricted to B cell lymphocytes. This protein is a reliable marker for pre-B cells but its expression diminishes during terminal B cell differentiation in antibody secreting plasma cells. The protein has two N-terminal extracellular Ig-like domains separated by a non-Ig-like domain, a hydrophobic transmembrane domain, and a large C-terminal cytoplasmic domain. This protein forms a complex with several membrane proteins including complement receptor type 2 (CD21) and tetraspanin (CD81) and this complex reduces the threshold for antigen-initiated B cell activation. Activation of this B-cell antigen receptor complex activates the phosphatidylinositol 3-kinase signalling pathway and the subsequent release of intracellular stores of calcium ions. This protein is a target of chimeric antigen receptor (CAR) T-cells used in the treatment of lymphoblastic leukemia. Mutations in this gene are associated with the disease common variable immunodeficiency 3 (CVID3) which results in a failure of B-cell differentiation and impaired secretion of immunoglobulins. CVID3 is characterized by hypogammaglobulinemia, an inability to mount an antibody response to antigen, and recurrent bacterial infections. Alternative splicing results in multiple transcript variants encoding distinct isoforms. provided by RefSeq, Jul 2020
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001770" in other vectors (6)
SKU Description Size Price
RC202922 CD19 (Myc-DDK-tagged)-Human CD19 molecule (CD19), transcript variant 2 10 ug
$776.00
RC202922L1 Lenti ORF clone of Human CD19 molecule (CD19), transcript variant 2, Myc-DDK-tagged 10 ug
$1,076.00
RC202922L2 Lenti ORF clone of Human CD19 molecule (CD19), transcript variant 2, mGFP tagged 10 ug
$1,076.00
RC202922L3 Lenti ORF clone of Human CD19 molecule (CD19), transcript variant 2, Myc-DDK-tagged 10 ug
$1,076.00
RC202922L4 Lenti ORF clone of Human CD19 molecule (CD19), transcript variant 2, mGFP tagged 10 ug
$1,076.00
RG202922 CD19 (tGFP-tagged) - Human CD19 molecule (CD19), transcript variant 2 10 ug
$489.00 $976.00

file-alt Citations

A new approach to CAR T-cell gene engineering and cultivation using piggyBac transposon in the presence of IL-4, IL-7 and IL-21
Ptáčková, Musil, Štach et al
Cytotherapy (2018)
AI Summary: In this study, OriGene's cDNA clone SC127938 was used to transfect HEK293 cells with CD19, enabling the activation and evaluation of CAR19 T cells during the development and testing of a novel CAR T-cell engineering protocol.
Snippet: growth rate. HEK293 (ATCC CRL-1573) cells were kept in Dulbecco's Modified Eagle's Medium and transfected with cDNA encoding CD19 (Origene cDNA clone SC127938) using Metafectene Pro reagent (Biontex). Ramos
4-1BB costimulation ameliorates T cell exhaustion induced by tonic signaling of chimeric antigen receptors
Long, Haso, Shern et al
Nat. Med. (2015)
Cited by 1847
AI Summary: OriGene’s pCMV6-XL5 vector containing CD19 (NM_001770.3) was used to transfect 143B osteosarcoma cells, enabling the creation of a CD19+GD2+ cell line (143B-CD19) for functional studies of CAR T cell exhaustion in this paper.
Snippet: …The GD2+ human osteosarcoma cell line 143B was transfected with CD19 (NM_001770.3) in the pCMV6-XL5 vector (Origene) using Lipofectamine 2000 (Life Technologies) to create a new, CD19+GD2+ cell line (143B-CD19). To isolate a stable line expressing CD19, transfected cells underwent two rounds of flow sorting (FACSAria II, BD Bioscience) and single cell cloning. The following cell lines were cultured in DMEM (Life Technologies): 143B, 143B-CD19, 293GP (retroviral vector packaging line), 293T, and H3 (PG13-based, stable producer line of MSGV-FMC63-28z CD19 CAR retroviral vector)32. …
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products