OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PAX6 (NM_000280) Human Untagged Clone

Be the first to review this product
SKU
SC127933
PAX6 (untagged)-Human paired box 6 (PAX6), transcript variant 1
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA379655 PAX6 Rabbit polyclonal Antibody
100 ul
$410.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PAX6 or NM_000280"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PAX6
Synonyms AN; AN1; AN2; ASGD5; D11S812E; FVH1; MGDA; WAGR
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_000280, the custom clone sequence may differ by one or more nucleotides


ATGCAGAACAGTCACAGCGGAGTGAATCAGCTCGGTGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACT
CCACCCGGCAGAAGATTGTAGAGCTAGCTCACAGCGGGGCCCGGCCGTGCGACATTTCCCGAATTCTGCA
GGTGTCCAACGGATGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCA
ATCGGTGGTAGTAAACCGAGAGTAGCGACTCCAGAAGTTGTAAGCAAAATAGCCCAGTATAAGCGGGAGT
GCCCGTCCATCTTTGCTTGGGAAATCCGAGACAGATTACTGTCCGAGGGGGTCTGTACCAACGATAACAT
ACCAAGCGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGAC
GGCATGTATGATAAACTAAGGATGTTGAACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGTTGGTATC
CGGGGACTTCGGTGCCAGGGCAACCTACGCAAGATGGCTGCCAGCAACAGGAAGGAGGGGGAGAGAATAC
CAACTCCATCAGTTCCAACGGAGAAGATTCAGATGAGGCTCAAATGCGACTTCAGCTGAAGCGGAAGCTG
CAAAGAAATAGAACATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCATT
ATCCAGATGTGTTTGCCCGAGAAAGACTAGCAGCCAAAATAGATCTACCTGAAGCAAGAATACAGGTATG
GTTTTCTAATCGAAGGGCCAAATGGAGAAGAGAAGAAAAACTGAGGAATCAGAGAAGACAGGCCAGCAAC
ACACCTAGTCATATTCCTATCAGCAGTAGTTTCAGCACCAGTGTCTACCAACCAATTCCACAACCCACCA
CACCGGTTTCCTCCTTCACATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTCACAAACACCTACAG
CGCTCTGCCGCCTATGCCCAGCTTCACCATGGCAAATAACCTGCCTATGCAACCCCCAGTCCCCAGCCAG
ACCTCCTCATACTCCTGCATGCTGCCCACCAGCCCTTCGGTGAATGGGCGGAGTTATGATACCTACACCC
CCCCACATATGCAGACACACATGAACAGTCAGCCAATGGGCACCTCGGGCACCACTTCAACAGGACTCAT
TTCCCCTGGTGTGTCAGTTCCAGTTCAAGTTCCCGGAAGTGAACCTGATATGTCTCAATACTGGCCAAGA
TTACAGTAA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_000280 unedited
TTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGGAAAACTCTCACCA
GCAACTCCTTTAAAACACCGTCATTTCAAACCATTGTGGTCTTCAAGCAACAACAGCAGC
ACAAAAAACCCCAACCAAACAAAACTCTTGACAGAAGCTGTGACAACCAGAAAGGATGCC
TCATAAAGGGGGAAGACTTTAACTAGGGGCGCGCAGATGTGTGAGGCCTTTTATTGTGAG
AGTGGACAGACATCCGAGATTTCAGAGCCCCATATTCGAGCCCCGTGGAATCCCGCGGCC
CCCAGCCAGAGCCAGCATGCAGAACAGTCACAGCGGAGTGAATCAGCTCGGTGGTGTCTT
TGTCAACGGGCGGCCACTGCCGGACTCCACCCGGCAGAAGATTGTAGAGCTAGCTCACAG
CGGGGCCCGGCCGTGCGACATTTCCCGAATTCTGCAGGTGTCCAACGGATGTGTGAGTAA
AATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCAATCGGTGGTAGTAA
ACCGAGAGTAGCGACTCCAGAAGTTGTAAGCAAAATAGCCCAGTATAAGCGGGAGTGCCC
GTCCATCTTTGCTTGGGAAATCCGAGACAGATTACTGTCCGAGGGGGTCTGTACCAACGA
TAACATACCAAGCGTGTCATCAATAAACAGAGTTCTTCGCAACCTGNCTAGCGANAAGCA
CAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATGTTGAACGGGCAGACCGGAAGC
TGGGGCACCCGNCCTGGTTGGTATCCNGGGACTTTCGTGCAGGGCACCTACGCAGAATGC
TGNCAGCACAGAAGGAGGGGAGAGATACCACTNCTCANTNCAN
Restriction Sites NotI-NotI |
ACCN NM_000280
Insert Size 1600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000280.2, NP_000271.1
RefSeq Size 2816 bp
RefSeq ORF 1269 bp
Locus ID 5080
UniProt ID P26367
Cytogenetics 11p13
Domains homeobox, PAX
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, Transcription Factors
Protein Pathways Maturity onset diabetes of the young
Summary This gene encodes paired box protein Pax-6, one of many human homologs of the Drosophila melanogaster gene prd. In addition to a conserved paired box domain, a hallmark feature of this gene family, the encoded protein also contains a homeobox domain. Both domains are known to bind DNA and function as regulators of gene transcription. Activity of this protein is key in the development of neural tissues, particularly the eye. This gene is regulated by multiple enhancers located up to hundreds of kilobases distant from this locus. Mutations in this gene or in the enhancer regions can cause ocular disorders such as aniridia and Peter's anomaly. Use of alternate promoters and alternative splicing results in multiple transcript variants encoding different isoforms. Interestingly, inclusion of a particular alternate coding exon has been shown to increase the length of the paired box domain and alter its DNA binding specificity. Consequently, isoforms that carry the shorter paired box domain regulate a different set of genes compared to the isoforms carrying the longer paired box domain. provided by RefSeq, Mar 2019
Transcript Variant: This variant (1) initiates from the B (P1) promoter and encodes isoform a. Variants 1, 3, 6, 7, and 12-16 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_000280" in other vectors (6)
SKU Description Size Price
RC203815 PAX6 (Myc-DDK-tagged)-Human paired box 6 (PAX6), transcript variant 1 10 ug
$457.00
RC203815L1 Lenti ORF clone of Human paired box 6 (PAX6), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC203815L2 Lenti ORF clone of Human paired box 6 (PAX6), transcript variant 1, mGFP tagged 10 ug
$757.00
RC203815L3 Lenti ORF clone of Human paired box 6 (PAX6), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC203815L4 Lenti ORF clone of Human paired box 6 (PAX6), transcript variant 1, mGFP tagged 10 ug
$757.00
RG203815 PAX6 (tGFP-tagged) - Human paired box 6 (PAX6), transcript variant 1 10 ug
$489.00 $657.00

file-alt Citations

Transcriptional and structural control of cell identity genes
Fan
(2015)
Snippet: …Next, plasmids containing the full coding sequence of PAX6, OTX2, LHX2, MITF, SIX3, SOX9, GLIS3, FOXD1, or ZNF92 were obtained from Open Biosystems, Origene or the Dana Farber/Harvard Cancer Center DNA Resource Core (Table S11). …
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products