OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TMSB15B (NM_194324) Human Untagged Clone

Be the first to review this product
SKU
SC127270
TMSB15B (untagged)-Human thymosin beta 15B (TMSB15B)
  $150.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TMSB15B or NM_194324"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TMSB15B
Synonyms Tbeta15b; TMSB15A; TMSL8; TMSNB
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_194324, the custom clone sequence may differ by one or more nucleotides


ATGAGTGATAAACCAGACTTGTCGGAAGTGGAGAAGTTTGACAGGTCAAAACTGAAGAAAACTAATACTG
AAGAAAAAAATACTCTTCCCTCAAAGGAAACTATCCAGCAGGAGAAAGAGTGTGTTCAAACATCATAA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_194324 unedited
TTCGGATTTGTAAACGACTCATATAGGGCGGCCGCGATTCCCGGGATTGCAGGGCTCTGG
GCGGGAAGGCTAACCTGGTGCGGAGCCAGCCTGGGTCTCAGCCCCGCGTACGGCCTTTCA
CGAGTCTTCAAGCCTTCAGGCTTTCTTCTAGTCAAGATGAGTGATAAACCAGACTTGTCG
GAAGTGGAGAAGTTTGACAGGTCAAAACTGAAGAAAACTAATACTGAAGAAAAAAATACT
CTTCCCTCAAAGGAAAAACTTCATTATGTGCGATATGGCAAGAGAGAAAGTGAATACGCT
GATATAAGAAGCAAGAAACCTTCCTTCCTTCCAGATGTGTGTCAGTAGAATTACAGAGTG
TCCACGGAAACAGCTCATGCCCTAGTGTACAGTGGTGCAGCCAATGAGTGACCTGAAGTC
TATGAGCAACACTCATTGTCCCAATGTGGGACGAGTGACCGAAGCTGAACCCACAACAGC
CTTCCTGTGATATTCCACGTGGTGGTTAAAGGCATGGCGATGTGATTCTTTACCTGATGT
TTTTGTTTGCAGTGTTTGTAATCATGGTCTTTTAGGGATATGAATCCAAAGCTAAGATTA
ATATACGTTCCTTGACCCTAACATCAAGTTATACAGAGCATTGTCAGCCATTAGAAGAAG
TCAGNATACGCTTATTTCCTCAAAAGATGGCATATTAAATTCACGTTAATATTAATACAA
GCTACCTTTTATTGTGCTCTCTTCTGGGTCCCAAGTCTTGGTATTTTTAGAATTTTTTTT
TTCCTATAGTGTATTGCTGGATTTCAAGCAGGTGCTGACTTACCCATTGCTTTCCTTTTC
ACTGGTTTCCATCGCCCGATTTGTGGACAAGAGACATCTCTGGGATTGGCACCCCAGGAA
TTATTATGTTGGCGCTTGAGCTCATATTGG
Restriction Sites Please inquire |
ACCN NM_194324
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_194324.1, NP_919305.1
RefSeq Size 1729 bp
RefSeq ORF 192 bp
Locus ID 286527
UniProt ID Q99406
Cytogenetics Xq22.2
Summary Plays an important role in the organization of the cytoskeleton. Binds to and sequesters actin monomers (G actin) and therefore inhibits actin polymerization (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the canonical isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_194324" in other vectors (4)
SKU Description Size Price
RC206981 TMSB15B (Myc-DDK-tagged)-Human thymosin beta 15B (TMSB15B) 10 ug
$150.00
RC206981L3 Lenti ORF clone of Human thymosin beta 15B (TMSB15B), Myc-DDK-tagged 10 ug
$450.00
RC206981L4 Lenti ORF clone of Human thymosin beta 15B (TMSB15B), mGFP tagged 10 ug
$450.00
RG206981 TMSB15B (tGFP-tagged) - Human thymosin beta 15B (TMSB15B) 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products