OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

FEZ1 (NM_022549) Human Untagged Clone

Be the first to review this product
SKU
SC126653
FEZ1 (untagged)-Human fasciculation and elongation protein zeta 1 (zygin I) (FEZ1), transcript variant 2
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA303166 Goat Polyclonal Antibody against FEZ1
100 ug
$565.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "FEZ1 or NM_022549"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FEZ1
Synonyms UNC-76
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_022549, the custom clone sequence may differ by one or more nucleotides


ATGGAGGCCCCACTGGTGAGTCTGGATGAAGAGTTTGAGGACCTTCGACCCTCCTGCTCGGAGGACCCGG
AGGAGAAGCCCCAGTGTTTCTATGGTTCATCTCCCCACCATCTCGAGGACCCCTCCCTCTCCGAGCTTGA
GAATTTTTCTTCCGAAATAATCAGCTTCAAGTCCATGGAGGACCTCGTAAATGAATTTGATGAGAAGCTC
AATGTCTGCTTTCGGAACTACAACGCCAAGACCGAGAACCTAGCTCCCGTGAAGAACCAGTTACAGATCC
AAGAGGAGGAGGAGACCCTTCAGGACGAGGAGTAA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_022549 unedited
TTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTCCGGCTGAGCCCC
GGGATCCGCCTCCCTCCGCCAGGACCCGCACAGATAAACTCATCCTGAAAGTCGCTGTTG
TTCTCCTGCTGAGCAAGAATGGAGGCCCCACTGGTGAGTCTGGATGAAGAGTTTGAGGAC
CTTCGACCCTCCTGCTCGGAGGACCCGGAGGAGAAGCCCCAGTGTTTCTATGGTTCATCT
CCCCACCATCTCGAGGACCCCTCCCTCTCCGAGCTTGAGAATTTTTCTTCCGAAATAATC
AGCTTCAAGTCCATGGAGGACCTCGTAAATGAATTTGATGAGAAGCTCAATGTCTGCTTT
CGGAACTACAACGCCAAGACCGAGAACCTAGCTCCCGTGAAGAACCAGTTACAGATCCAA
GAGGAGGAGGAGACCCTTCAGGACGAGGAGGTTTGGGATGCTCTGACAGACAATTACATC
CCTTCACTCTCAGAAGACTGGAGGGATCCAAACATCGAGGCTCTGAATGGCAACTGCTCT
GACACTGAGATCCATGAGAAAGAAGAGGAAGAGTTCAATGAGAAGAGTGAAAATGATTCC
GGTATCAACGAGGAGCCTCTGCTCACAGCAGATCAGGTAATTGAGGAGATTGAGGAAATG
ATGCAGAACTCCCCANACCCTGAAGAAGAAGAGGAAGGTCTGGAAGAAAAGATGGAGGAG
AAACTTCCTCCAGNCAGACTCGGTCCTTCTGCAAGAGAGCAGGCATTGACACAGACCTTA
NCAACAACTGGGTCTATTAAGGGCTGANGCACATGTTTGGTCTGAGCTGACGAGCTCGTG
AACAGTTGGAGGGGCCTTCCGTGACTCTCGGAGAACCTGTGCACACCTGCCCGCCGGACA
GCTTGAGTTGAGAGAGAGGAAAACCTTTTACCGA
Restriction Sites NotI-NotI |
ACCN NM_022549
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_022549.2, NP_072043.1
RefSeq Size 1753 bp
RefSeq ORF 315 bp
Locus ID 9638
UniProt ID Q99689
Cytogenetics 11q24.2
Summary This gene is an ortholog of the C. elegans unc-76 gene, which is necessary for normal axonal bundling and elongation within axon bundles. Expression of this gene in C. elegans unc-76 mutants can restore to the mutants partial locomotion and axonal fasciculation, suggesting that it also functions in axonal outgrowth. The N-terminal half of the gene product is highly acidic. Alternatively spliced transcript variants encoding different isoforms of this protein have been described. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) encodes a protein isoform (2) that is truncated at the C-terminal end compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_022549" in other vectors (4)
SKU Description Size Price
RC217971 FEZ1 (Myc-DDK-tagged)-Human fasciculation and elongation protein zeta 1 (zygin I) (FEZ1), transcript variant 2 10 ug
$150.00
RC217971L3 Lenti ORF clone of Human fasciculation and elongation protein zeta 1 (zygin I) (FEZ1), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC217971L4 Lenti ORF clone of Human fasciculation and elongation protein zeta 1 (zygin I) (FEZ1), transcript variant 2, mGFP tagged 10 ug
$450.00
RG217971 FEZ1 (tGFP-tagged) - Human fasciculation and elongation protein zeta 1 (zygin I) (FEZ1), transcript variant 2 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products