OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

BCMA (TNFRSF17) (NM_001192) Human Untagged Clone

Be the first to review this product
SKU
SC125656
BCMA/TNFRSF17 (untagged)-Human tumor necrosis factor receptor superfamily, member 17 (BCMA/TNFRSF17)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA814060 TNFRSF17 mouse monoclonal antibody, clone OTI3H5 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "BCMA or NM_001192"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BCMA
Synonyms BCM; BCMA; CD269; TNFRSF13A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001192 edited
GAATTCTTGTAGAGATATTACTTGTCCTTCCAGGCTGTTCTTTCTGTAGCTC
CCTTGTTTTCTTTTTGTGATCATGTTGCAGATGGCTGGGCAGTGCTCCCAAAATGAATAT
TTTGACAGTTTGTTGCATGCTTGCATACCTTGTCAACTTCGATGTTCTTCTAATACTCCT
CCTCTAACATGTCAGCGTTATTGTAATGCAAGTGTGACCAATTCAGTGAAAGGAACGAAT
GCGATTCTCTGGACCTGTTTGGGACTGAGCTTAATAATTTCTTTGGCAGTTTTCGTGCTA
ATGTTTTTGCTAAGGAAGATAAGCTCTGAACCATTAGAGGACGAGTTTAAAAACACAGGA
TCAGGTCTCCTGGGCATGGCTAACATTGACCTGGAAAAGAGCAGGACTGGTGATGAAATT
ATTCTTCCGAGAGGCCTCGAGTACACGGTGGAAGAATGCACCTGTGAAGACTGCATCAAG
AGCAAACCGAAGGTCGACTCTGACCATTGCTTTCCACTCCCAGCTATGGAGGAAGGCGCA
ACCATTCTTGTCACCACGAAAACGAATGACTATTGCAAGAGCCTGCCAGCTGCTTTGAGT
GCTACGGAGATAGAGAAATCAATTTCTGCTAGGTAATTAACCATTTCGACTCGAGCAGTG
CCACTTTAAAAATCTTTTGTCAGAATAGATGATGTGTCAGATCTCTTTAGGATGACTGTA
TTTTTCAGTTGCCGATACAGCTTTTTGTCCTCTAACTGTGGAAACTCTTTATGTTAGATA
TATTTCTCTAGGTTACTGTTGGGAGCTTAATGGTAGAAACTTCCTTGGTTTCATGATTAA
AGTCTTTTTTTTTCCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001192 unedited
TGTAGAGATTTACTTGTCCTTCCGGCTGTTCTTTCTGTAGCTCCCTTGTTTTCTTTTTGT
GATCATGTTGCAGATGGCTGGGCAGTGCTCCCAAAATGAATATTTTGACAGTTTGTTGCA
TGCTTGCATACCTTGTCAACTTCGATGTTCTTCTAATACTCCTCCTCTAACATGTCAGCG
TTATTGTAATGCAAGTGTGACCAATTCAGTGAAAGGAACGAATGCGATTCTCTGGACCTG
TTTGGGACTGAGCTTAATAATTTCTTTGGCAGTTTTCGTGCTAATGTTTTTGCTAAGGAA
GATAAGCTCTGAACCATTAGAGGACGAGTTTAAAAACACAGGATCAGGTCTCCTGGGCAT
GGCTAACATTGACCTGGAAAAGAGCAGGACTGGTGATGAAATTATTCTTCCGAGAGGCCT
CGAGTACACGGTGGAAGAATGCACCTGTGAAGACTGCATCAAGAGCAAACCGAAGGTCGA
CTCTGACCATTGCTTTCCACTCCCAGCTATGGAGGAAGGCGCAACCATTCTTGTCACCAC
GAAAACGAATGACTATTGCAAGAGCCTGCCAGCTGCTTTGAGTGCTACGGAGATAGAGAA
ATCAATTTCTGCTAGGTAATTAACCATTTCGACTCGAGCAGTGCCACTTTAAAAATCTTT
TGTCAGAATAGATGATGTGTCAGATCTCTTTAGGATGACTGTATTTTTCAGTTGCCGATA
CAGCTTTTTGTCCTCNTACTGTGGAAACTCTTTATGTTAGATATATTTCTCTAGGTTACT
GTTGGGAGCTTAATGGTA
Restriction Sites Please inquire |
ACCN NM_001192
Insert Size 555 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001192.2, NP_001183.2
RefSeq Size 994 bp
RefSeq ORF 555 bp
Locus ID 608
UniProt ID Q02223
Cytogenetics 16p13.13
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction
Summary The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B/TALL-1/BAFF), and to lead to NF-kappaB and MAPK8/JNK activation. This receptor also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001192" in other vectors (6)
SKU Description Size Price
RC208851 BCMA/TNFRSF17 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 17 (BCMA/TNFRSF17) 10 ug
$289.00 $450.00
RC208851L1 Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 17 (BCMA/TNFRSF17), Myc-DDK-tagged 10 ug
$750.00
RC208851L2 Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 17 (BCMA/TNFRSF17), mGFP tagged 10 ug
$750.00
RC208851L3 Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 17 (BCMA/TNFRSF17), Myc-DDK-tagged 10 ug
$750.00
RC208851L4 Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 17 (BCMA/TNFRSF17), mGFP tagged 10 ug
$750.00
RG208851 BCMA/TNFRSF17 (tGFP-tagged) - Human tumor necrosis factor receptor superfamily, member 17 (BCMA/TNFRSF17) 10 ug
$489.00 $650.00

file-alt Citations

γ-secretase directly sheds the survival receptor BCMA from plasma cells
Laurent, Hoffmann, Kuhn et al
Nat Commun (2015) 6, 7333 DOI: 10.1038/ncomms8333
Cited by 377
AI Summary: OriGene products, specifically the human BCMA cDNA clone and the pCMV6-AN-DDK vector, were used to generate FLAG-tagged and modified BCMA constructs for investigating γ-secretase-mediated shedding of BCMA in this study.
Snippet: To obtain BCMA with an N-terminal FLAG-tag, full-length human BCMA (h184) from a human BCMA cDNA clone (OriGene Technologies) was first amplified by PCR. … This construct does not contain a signal peptide, since the native BCMA also does not contain one23. To obtain a BCMA variant with a prolonged extracellular part, the extracellular part of human BCMA was amplified by PCR, digested and ligated at the N-terminal end of full-length human BCMA clone (OriGene Technologies)
The Immunoregulator Soluble TACI Is Released by ADAM10 and Reflects B Cell Activation in Autoimmunity
Hoffmann, Kuhn, Laurent et al
J. Immunol. (2015) 194 (2), 542-52 DOI: 10.4049/jimmunol.1402070
Cited by 111
AI Summary: OriGene products contributed to this study by providing the plasmids Human TACI in pCMV6-XL4, Human BCMA in pCMV6-XL5, and the control vector pCMV6-AN-DDK, which were used to investigate the processing and function of TACI in B cell activation and autoimmunity.
Snippet: Intrathecal IgG production was calculated as: IgG-index (CSF IgG/CSF albumin)/(serum IgG/serum albumin). Plasmids Human TACI in pCMV6-XL4, human BCMA in pCMV6-XL5, and the control vector pCMV6-AN-DDK were purchased from Origene Technol- ... Cite SaveSaving
B-cell maturation antigen is a promising target for adoptive T-cell therapy of multiple myeloma
Carpenter, Evbuomwan, Pittaluga et al
Clin. Cancer Res. (2013) 19 (8), 2048-60 DOI: 10.1158/1078-0432.CCR-12-2422
Cited by 2
AI Summary: OriGene’s Human Major Tissue qPCR panel II was used in this study to quantify BCMA cDNA levels across various human tissues, helping to assess the tissue specificity of BCMA expression as a potential CAR-T cell therapy target for multiple myeloma.
Snippet: We quantitated BCMA cDNA copies in samples of cDNA from human tissues included in the Human Major Tissue qPCR panel II (Origene) by conducting quantitative PCR (qPCR) with a BCMA-specific primer and probe set (Applied Biosystems, catalog number 4331182).
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products