OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

HMGN3 (NM_004242) Human Untagged Clone

Be the first to review this product
SKU
SC125366
HMGN3 (untagged)-Human high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 1
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA339226 Rabbit Polyclonal Anti-HMGN3
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "HMGN3 or NM_004242"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HMGN3
Synonyms PNAS-24; PNAS-25; TRIP7
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_004242, the custom clone sequence may differ by one or more nucleotides


ATGCCGAAGAGAAAGTCTCCAGAGAATACAGAGGGCAAAGATGGATCCAAAGTAACTAAACAGGAGCCCA
CAAGACGGTCTGCCAGATTGTCAGCGAAACCTGCTCCACCAAAACCTGAACCCAAACCAAGAAAAACATC
TGCTAAGAAAGAACCTGGAGCAAAGATTAGCAGAGGTGCTAAAGGGAAGAAGGAGGAAAAGCAGGAAGCT
GGAAAGGAAGGTACTGCACCATCTGAAAATGGTGAAACTAAAGCTGAAGAGGCACAGAAAACTGAATCTG
TAGATAACGAGGGAGAATGA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_004242 unedited
CCCCTTCTAACCCCGCCCGTTGNCGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTAT
ATAAGCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCG
GCCGCGAATTCGGCACGAGGGTCGTGCCCTGCGCGTGAGCAGCTGCAGCGGCAGAGGCAG
CATCCAGCGGCGGCGCCAGCAGTTCCAGTCCGTTGCTTTACTTTTTGCTTCACCGACATA
GTCATTATGCCGAAGAGAAAGTCTCCAGAGAATACAGAGGGCAAAGATGGATCCAAAGTA
ACTAAACAGGAGCCCACAAGACGGTCTGCCAGATTGTCAGCGAAACCTGCTCCACCANAA
CCTGNAACCAAACCAAGAAAAACATCTGCTAAGAAAGAACCTGGAGCAAAGATTAGCAGA
AGTGCTAAGGGNAAGAANGANGAAAAGCANGNAGCTGNAAAGGAAAGTACNTGACCATCT
GAAAATGGTGAAACTAAAGCTGANNAGCCCAGAAAACTGAATCTGTGATAACCAGGGGAA
AATGAATTGCATGAAAAATTGGGGTGGTTTTAAGTTTCCCTGGGGAAACTTTTTAAAACC
ATTTTTCCACAGTTTTTTGAAAAGGCCATTTTTTAAAGGCCTCCCCTTTTGGCGACCAAA
ATATTAAGGGGGGGACTTTTTTCCGCCCAAAAACGGCGTTTTGGGAAATTTAAACCCCCC
CCCGGAAAAAAAAAATCCCTTTAAAATTTGGGGGCGCTGGGGAAAAAAATTTCCCCCCCC
CCCCGCCCCCCTCTAAAAAAAAAACCCCGCCCCCCACCGGGGGGTGTTTCCCGCGCCAAA
ATTAAATTTTTTTGCGCGTTTTTTAAAAAAAAAAAAAAAGGGGGGTTGTTCCCCACAATA
TTAAT
Restriction Sites NotI-NotI |
ACCN NM_004242
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004242.2, NP_004233.1
RefSeq Size 935 bp
RefSeq ORF 300 bp
Locus ID 9324
UniProt ID Q15651
Cytogenetics 6q14.1
Domains HMG14_17
Protein Families Druggable Genome
Summary The protein encoded by this gene binds thyroid hormone receptor beta in the presence of thyroid hormone. The encoded protein, a member of the HMGN protein family, is thought to reduce the compactness of the chromatin fiber in nucleosomes, thereby enhancing transcription from chromatin templates. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is a related pseudogene on chromosome 1. provided by RefSeq, Jan 2016
Transcript Variant: This variant (1) encodes isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_004242" in other vectors (6)
SKU Description Size Price
RC213403 HMGN3 (Myc-DDK-tagged)-Human high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 1 10 ug
$150.00
RC213403L1 Lenti ORF clone of Human high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC213403L2 Lenti ORF clone of Human high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 1, mGFP tagged 10 ug
$450.00
RC213403L3 Lenti ORF clone of Human high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC213403L4 Lenti ORF clone of Human high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 1, mGFP tagged 10 ug
$450.00
RG213403 HMGN3 (tGFP-tagged) - Human high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 1 10 ug
$350.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products