OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Lysozyme (LYZ) (NM_000239) Human Untagged Clone

Be the first to review this product
SKU
SC125273
LYZ (untagged)-Human lysozyme (LYZ)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA506191 LYZ mouse monoclonal antibody, clone OTI1C9 (formerly 1C9) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Lysozyme or NM_000239"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Lysozyme
Synonyms LYZF1; LZM
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_000239 edited
ATGAAGGCTCTCATTGTTCTGGGGCTTGTCCTCCTTTCTGTTACGGTCCAGGGCAAGGTC
TTTGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAGATTGGGAATGGATGGCTACAGGGGA
ATCAGCCTAGCAAACTGGATGTGTTTGGCCAAATGGGAGAGTGGTTACAACACACGAGCT
ACAAACTACAATGCTGGAGACAGAAGCACTGATTATGGGATATTTCAGATCAATAGCCGC
TACTGGTGTAATGATGGCAAAACCCCAGGAGCAGTTAATGCCTGTCATTTATCCTGCAGT
GCTTTGCTGCAAGATAACATCGCTGATGCTGTAGCTTGTGCAAAGAGGGTTGTCCGTGAT
CCACAAGGCATTAGAGCATGGGTGGCATGGAGAAATCGTTGTCAAAACAGAGATGTCCGT
CAGTATGTTCAAGGTTGTGGAGTGTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000239 unedited
CCCGTTCAAATTTTGTAATACGACTCACTTATAGGGCGGCCGCGAATTCGCACGAAACCT
AGCAGTCAACATGAAGGCTCTCATTGTTCTGGGGCTTGTCCTCCTTTCTGTTACGGTCCA
GGGCAAGGTCTTTGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAGATTGGGAATGGATGG
CTACAGGGGAATCAGCCTAGCAAACTGGATGTGTTTGGCCAAATGGGAGAGTGGTTACAA
CACACGAGCTACAAACTACAATGCTGGAGACAGAAGCACTGATTATGGGATATTTCAGAT
CAATAGCCGCTACTGGTGTAATGATGGCAAAACCCCAGGAGCAGTTAATGCCTGTCATTT
ATCCTGCAGTGCTTTGCTGCAAGATAACATCGCTGATGCTGTAGCTTGTGCAAAGAGGGT
TGTCCGTGATCCACAAGGCATTAGAGCATGGGTGGCATGGAGAAATCGTTGTCAAAACAG
AGATGTCCGTCAGTATGTTCAAGGTTGTGGAGTGTAACTCCAGAATTTTCCTTCTTCAGC
TCATTTTGTCTCTCTCACATTAAGGGAGTAGGAATTAAGTGAAAGGTCACACTACCATTA
TTTCCCCTTCAAACAAATAATATTTTTACAGAAGCAGGAGCAAAATATGGCCTTTCTTCT
AAGAGATATAATGTTCACTAATGTGGTTATTTTATATTAAGCCTACAACATTNTTCAGTT
TGCANATAGAACTAATACTGGTGAAAATTTACCTAAAACCTTGGTTATCAAATACATCTC
CAGTACATTCCGTTCTTTTTTTTTTTGAGACAGTCTCGCTCTGTCGCCCCAGCTGGAGTG
CAGTGGCGCAATCTCGGCTCACTGCAACCTNCACCTCCCGGGTTCACGCCATTCTNCTGC
CTCACCTNCCGAGTAGCTGGGATTACCGGCGCCCGN
Restriction Sites NotI-NotI |
ACCN NM_000239
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000239.1, NP_000230.1
RefSeq Size 1487 bp
RefSeq ORF 447 bp
Locus ID 4069
UniProt ID P61626
Cytogenetics 12q15
Domains lys
Protein Families Druggable Genome
Summary This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta1-4glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the antimicrobial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. The protein has antibacterial activity against a number of bacterial species. Missense mutations in this gene have been identified in heritable renal amyloidosis. provided by RefSeq, Oct 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_000239" in other vectors (6)
SKU Description Size Price
RC200730 LYZ (Myc-DDK-tagged)-Human lysozyme (LYZ) 10 ug
$150.00
RC200730L1 Lenti ORF clone of Human lysozyme (LYZ), Myc-DDK-tagged 10 ug
$450.00
RC200730L2 Lenti ORF clone of Human lysozyme (LYZ), mGFP tagged 10 ug
$450.00
RC200730L3 Lenti ORF clone of Human lysozyme (LYZ), Myc-DDK-tagged 10 ug
$450.00
RC200730L4 Lenti ORF clone of Human lysozyme (LYZ), mGFP tagged 10 ug
$450.00
RG200730 LYZ (tGFP-tagged) - Human lysozyme (LYZ) 10 ug
$489.00

file-alt Citations

Efficient secretion of small proteins in mammalian cells relies on Sec62-dependent posttranslational translocation
Lakkaraju, Thankappan, Mary et al
Mol. Biol. Cell (2012) 23 (14), 2712-22 DOI: 10.1091/mbc.E12-03-0228
Cited by 11
AI Summary: In this study, OriGene's Sec62 shRNA (Cat# TL313970) was used to efficiently reduce Sec62 protein levels in mammalian cells, enabling the authors to investigate the role of Sec62 in the posttranslational translocation of small secretory proteins.
Snippet: cells. Two different short hairpin RNAs (shRNAs) efficiently reduced the cellular levels of Sec62 starting at 72 h posttransfection (Figure 2A, left and right). In ... Short reporter proteins can be coimmunoprecipitated with Sec62. To strengthen
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products