OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

hCG (CGA) (NM_000735) Human Untagged Clone

Be the first to review this product
SKU
SC119734
CGA (untagged)-Human glycoprotein hormones, alpha polypeptide (CGA)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA349798 Rabbit Polyclonal Anti-CGA Antibody
100 ul
$205.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "hCG or NM_000735"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol hCG
Synonyms CG-ALPHA; FSHA; GPA1; GPHa; GPHA1; HCG; LHA; TSHA
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119734 sequence for NM_000735 edited (data generated by NextGen Sequencing)
ATGGATTACTACAGAAAATATGCAGCTATCTTTCTGGTCACATTGTCGGTGTTTCTGCAT
GTTCTCCATTCCGCTCCTGATGTGCAGGATTGCCCAGAATGCACGCTACAGGAAAACCCA
TTCTTCTCCCAGCCGGGTGCCCCAATACTTCAGTGCATGGGCTGCTGCTTCTCTAGAGCA
TATCCCACTCCACTAAGGTCCAAGAAGACGATGTTGGTCCAAAAGAACGTCACCTCAGAG
TCCACTTGCTGTGTAGCTAAATCATATAACAGGGTCACAGTAATGGGGGGTTTCAAAGTG
GAGAACCACACGGCGTGCCACTGCAGTACTTGTTATTATCACAAATCTTAA

Clone variation with respect to NM_000735.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000735 unedited
GCTGGATTTAGGNAATCCGNATTTCACTATAGGGCGAGCCGCGCAATTCGGCACCAGNAC
GAAGCTAAAATCCCTCTTCGGATCCACAGTCAACCGCCCTGAACACTCCTGCAAAAAGCC
CAGAGAAAGGAGCGCCATGGATTACTACAGAAAATATGCAGCTATCTTTCTGGTCACATT
GTCGGTGTTTCTGCATGTTCTCCATTCCGCTCCTGTATGTTCAGGATTGCCCAGAATGCA
CGCTACAGGAAAACCCATTCTTCTCCCAGCCGGGTGCCCCAATACTTCAGTGCATGGGCT
GCTGCTTCTCTAGAGCATATCCCACTCCACTAAGGTCCAAGAAGACGATGTTGGTCCAAA
AGAACGTCACCTCAGAGTCCACTTGCTGTGTAGCTAAATCATATAACAGGGTCACAGTAA
TGGGGGGTTTCAAAGTGGAGAACCACACGGCGTGCCACTGCAGTACTTGTTATTATCACA
AATCTTAAATGTTTTACCAAGTGCTGTCTTGATGACTGCTGATTTTCTGGAATGGAAAAT
TAAGTTGTTTAGTGTTTATGGCTTTGTGAGATAAAACTCTCCTTTTCCTTACCATACCAC
TTTGACACGCTTCAAGGATATACTGCAGCTTTACTGCCTTCCTCCTTATCCTACAGTACA
ATCAGCAGTCTAGTTCTTTTCATTTGGGATGAATACAGCATTTAGCTTGGTCCACTGCAA
ATAAAGCCTTTTTAATCATCAAAAAAAAAAAAAAAAACTCGACTCTAGATTGCNGCCGCG
GTCATAGCTGTTTCCCTGACAGATCCCGGGTGGCATCCCTGTGACCCTCCCCAATGCCTT
TCTGGGCCTGGAAGTGCCCCTCCAGTGCCAACAAACTTGGGCCTATAAATAAAGTGCATC
ATTTTGNCTGACAAGGTGTCCCTCTTAAATTATGGGTTGAGAGGGTTGTGTTGAAAACCA
GGGCAAATTTGGAAAAAA
Restriction Sites NotI-NotI |
ACCN NM_000735
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000735.2, NP_000726.1
RefSeq Size 704 bp
RefSeq ORF 351 bp
Locus ID 1081
UniProt ID P01215
Cytogenetics 6q14.3
Domains GHA
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein
Protein Pathways Autoimmune thyroid disease, GnRH signaling pathway, Neuroactive ligand-receptor interaction
Summary The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Nov 2011
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_000735" in other vectors (6)
SKU Description Size Price
RC203146 CGA (Myc-DDK-tagged)-Human glycoprotein hormones, alpha polypeptide (CGA) 10 ug
$150.00
RC203146L1 Lenti ORF clone of Human glycoprotein hormones, alpha polypeptide (CGA), Myc-DDK-tagged 10 ug
$450.00
RC203146L2 Lenti ORF clone of Human glycoprotein hormones, alpha polypeptide (CGA), mGFP tagged 10 ug
$450.00
RC203146L3 Lenti ORF clone of Human glycoprotein hormones, alpha polypeptide (CGA), Myc-DDK-tagged 10 ug
$450.00
RC203146L4 Lenti ORF clone of Human glycoprotein hormones, alpha polypeptide (CGA), mGFP tagged 10 ug
$450.00
RG203146 CGA (tGFP-tagged) - Human glycoprotein hormones, alpha polypeptide (CGA) 10 ug
$489.00

file-alt Citations

Comparative Assessment on the Expression Level of Recombinant Human Follicle-Stimulating Hormone (FSH) in Serum-Containing Versus Protein-Free Culture Media
Jazayeri, Amiri-Yekta, Gourabi et al
Mol. Biotechnol. (2017) 59 (11-12), 490-498 DOI: 10.1007/s12033-017-0037-4
AI Summary: In this study, the pCMV6-XL4 vector from OriGene, containing the a-FSH cDNA, was used as the source for constructing the expression cassette to produce recombinant human follicle-stimulating hormone (FSH) in CHO cell lines.
Snippet: Materials and Methods Expression Cassette Construction a-FSH cDNA obtained from the pCMV6-XL4 vector (OriGene) was cloned into the pOptiVECTM-TOPOO vec- tor (Thermo Fisher Scientific) just before IRES, using NheI and EcoRV (Fermentas). ...;... Materials and Methods Expression Cassette Construction a-FSH cDNA obtained from the pCMV6-XL4 vector (OriGene) was cloned into the pOptiVECTM-TOPOO vec- tor...
Chromogranin A induces the biogenesis of granules with calcium- and actin-dependent dynamics and exocytosis in constitutively secreting cells
Elias, Delestre, Ory et al
Endocrinology (2012) 153 (9), 4444-56 DOI: 10.1210/en.2012-1436
Cited by 29
AI Summary: OriGene contributed to this study by providing the cDNA encoding human Chromogranin A (CgA), which was essential for generating CgA-expressing COS-7 cells to investigate granule biogenesis and dynamics.
Snippet: into the eukaryotic expression vector pIRESneo2 plasmid (BD Clontech, Palo Alto, CA), as previously described (9). The cDNA encoding human CgA was obtained from Origene (Rockville, MD ... This value was used as a filter to eliminate those vesicles displaying short lifespans.
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products