OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

IRF3 (NM_001571) Human Untagged Clone

Be the first to review this product
SKU
SC119140
IRF3 (untagged)-Human interferon regulatory factor 3 (IRF3), transcript variant 1
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA500465 Anti-IRF3 mouse monoclonal antibody, clone OTI5D2 (formerly 5D2) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "IRF3 or NM_001571"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IRF3
Synonyms IIAE7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001571 edited
CCCACGCGTCCGCTACCCTGAAAGTGGGGATACTTACTTTCGATGATGTGGGGGAGGGAG
GAGGTCTATACTGGCGGAATTGAGGGAGTGGAGGGTCTGCACTGAAGACGCTGGGGAAGG
ATGTGCCATGGATATGGGAAGGAACCCTAGCTGATTAGAGAGCCTCTCGGGAGGATGGGA
GGATGGGAAGAGGAGGTTTCCTGTTTGTACCCCCGAAAATATGGGTGAAGGACCTGTGCC
GTGGCCCGTGAGAAGGAGGTCTGGGTGCGGAAACTCCAGGCCAGGTGGGTCCGGGGGAGG
CCGGTCGCGCCCAGGAAATGCCCTATACGCGCAGGCCGGACCATGGGAACCCCAAAGCCA
CGGATCCTGCCCTGGCTGGTGTCGCAGCTGGACCTGGGGCAACTGGAGGGCGTGGCCTGG
GTGAACAAGAGCCGCACGCGCTTCCGCATCCCTTGGAAGCACGGCCTACGGCAGGATGCA
CAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCCACTGGTGCATATGTTCCC
GGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTCCGCTCTGCCCTCAACCGC
AAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCTCACGACCCACATAAAATC
TACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCAGACACCTCTCCGGACACC
AATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTGGATGAGTTACTGGGTAAC
ATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTGGCTGTAGCCCCTGAGCCC
TGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACTCCCTTCCCAAACCTGGGG
CCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAAGAGTGGGAGTTCGAGGTG
ACAGCCTTCTACCGGGGCCGCCAAGTCTTCCAGCAGACCATCTCCTGCCCGGAGGGCCTG
CGGCTGGTGGGGTCCGAAGTGGGAGACAGGACGCTGCCTGGATGGCCAGTCACACTGCCA
GACCCTGGCATGTCCCTGACAGACAGGGGAGTGATGAGCTACGTGAGGCATGTGCTGAGC
TGCCTGGGTGGGGGACTGGCTCTCTGGCGGGCCGGGCAGTGGCTCTGGGCCCAGCGGCTG
GGGCACTGCCACACATACTGGGCAGTGAGCGAGGAGCTGCTCCCCAACAGCGGGCATGGG
CCTGATGGCGAGGTCCCCAAGGACAAGGAAGGAGGCGTGTTTGACCTGGGGCCCTTCATT
GTAGATCTGATTACCTTCACGGAAGGAAGCGGACGCTCACCACGCTATGCCCTCTGGTTC
TGTGTGGGGGAGTCATGGCCCCAGGACCAGCCGTGGACCAAGAGGCTCGTGATGGTCAAG
GTTGTGCCCACGTGCCTCAGGGCCTTGGTAGAAATGGCCCGGGTAGGGGGTGCCTCCTCC
CTGGAGAATACTGTGGACCTGCACATTTCCAACAGCCACCCACTCTCCCTCACCTCCGAC
CAGTACAAGGCCTACCTGCAGGACTTGGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAG
AGCTGAGCCCTCGCTCCTCATGGTGTGCCTCCAACCCCCCTGTTCCCCACCACCTCAACC
AATAAACTGGTTCCTGCTATGAAAAAAAAAAAAAAA
Restriction Sites NotI-NotI |
ACCN NM_001571
Insert Size 1700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001571.2, NP_001562.1
RefSeq Size 1648 bp
RefSeq ORF 1284 bp
Locus ID 3661
UniProt ID Q14653
Cytogenetics 19q13.33
Domains IRF
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Cytosolic DNA-sensing pathway, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway
Summary This gene encodes a member of the interferon regulatory transcription factor (IRF) family. The encoded protein is found in an inactive cytoplasmic form that upon serine/threonine phosphorylation forms a complex with CREBBP. This complex translocates to the nucleus and activates the transcription of interferons alpha and beta, as well as other interferon-induced genes. The protein plays an important role in the innate immune response against DNA and RNA viruses. Mutations in this gene are associated with Encephalopathy, acute, infection-induced, herpes-specific, 7. provided by RefSeq, Sep 2020
Transcript Variant: This variant (1) encodes isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001571" in other vectors (6)
SKU Description Size Price
RC209951 IRF3 (Myc-DDK-tagged)-Human interferon regulatory factor 3 (IRF3), transcript variant 1 10 ug
$457.00
RC209951L1 Lenti ORF clone of Human interferon regulatory factor 3 (IRF3), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC209951L2 Lenti ORF clone of Human interferon regulatory factor 3 (IRF3), transcript variant 1, mGFP tagged 10 ug
$757.00
RC209951L3 Lenti ORF clone of Human interferon regulatory factor 3 (IRF3), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC209951L4 Lenti ORF clone of Human interferon regulatory factor 3 (IRF3), transcript variant 1, mGFP tagged 10 ug
$757.00
RG209951 IRF3 (tGFP-tagged) - Human interferon regulatory factor 3 (IRF3), transcript variant 1 10 ug
$489.00 $657.00

file-alt Citations

FoxO1 negatively regulates cellular antiviral response by promoting degradation of IRF3
Lei, Zhang, Xia et al
J. Biol. Chem. (2013) 288 (18), 12596-604 DOI: 10.1074/jbc.M112.444794
AI Summary: OriGene contributed to this study by providing mammalian cDNA expression plasmids, which were used to investigate the roles of FoxO1 and IRF3 in antiviral response.
Snippet: 1 To whom correspondence should be addressed: College of Life Sciences, Wuhan University, Wuhan 430072, China. Tel.: 86-27-68753795;Fax: 86-27-68753780;E-mail: shuh{at}whu.edu. cn. ... Mammalian cDNA expression plasmids were purchased from Origene company.
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products