OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MAFK (NM_002360) Human Untagged Clone

Be the first to review this product
SKU
SC118696
MAFK (untagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) (MAFK)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA342419 Rabbit Polyclonal Anti-MAFK Antibody
100 ul
$525.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MAFK or NM_002360"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAFK
Synonyms NFE2U; P18
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_002360 edited
ATGACGACTAATCCCAAACCGAATAAGGCATTAAAGGTCAAGAAGGAGGCGGGCGAGAAC
GCCCCGGTGCTCAGCGATGATGAGCTGGTGTCCATGTCGGTGCGGGAGCTGAACCAGCAC
CTGCGGGGTCTCACCAAGGAGGAGGTGACCCGCCTGAAGCAGCGTCGGCGCACACTCAAG
AACCGCGGCTACGCGGCCAGCTGCCGCATCAAGCGGGTGACGCAGAAGGAGGAGCTGGAG
CGGCAGCGCGTGGAGCTGCAGCAGGAGGTGGAGAAGCTGGCGCGTGAGAACAGCAGCATG
CGGCTGGAGCTGGACGCCCTGCGCTCCAAGTACGAGGCGCTGCAGACCTTCGCGCGCACC
GTGGCCCGGGGACCTGTGGCGCCCTCCAAGGTGGCCACCACCAGCGTCATCACCATCGTC
AAGTCCACCGAGCTCTCCTCCACCTCCGTGCCCTTCTCGGCTGCATCCTAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002360 unedited
NNNNGGTTTAAATTTGTATACGACTCACTATAGGGCGGCCGCGNAATTCGCACCAGGGGG
CACCTTGTGCTGTGCAGGTGCAGACGTCTTCTCTGACCTCAGGGAGAGTCAGAACAGGAA
GCAGCCACTGCCGGCGCCTGCTGGTCACCCCACAGTGCCGGCGGCTGCAGCCCAGCTACG
AGTTCCAGGGAGCTCTGTCCTGGTGACCGTGCCCGGGTTATGACGACTAATCCCAAACCG
AATAAGGCATTAAAGGTCAAGAAGGAGGCGGGCGAGAACGCCCCGGTGCTCAGCGATGAT
GAGCTGGTGTCCATGTCGGTGCGGGAGCTGAACCAGCACCTGCGGGGTCTCACCAAGGAG
GAGGTGACCCGCCTGAAGCAGCGTCGGCGCACACTCAAGAACCGCGGCTACGCGGCCAGC
TGCCGCATCAAGCGGGTGACGCANAAGGAGGAGCTGGAGCGGCAGCGCGTGGAGCTGCAG
CAGGAGGTGGAGAAGCTGGCGCGTGAGAACAGCAGCATGCGGCTGGAGCTGGACGCCCTG
CGCTCCAAGTACGAGGCGCTGCAGACCTTCGCGCGCACCGTGGCCCGGGGACCTGTGGCG
CCCTCCAAGGTGGCCACCACCAGCGTCATCACCATCGTCAAGTCCACCGAGCTCTCCTCC
ACCTCCGTGCCCTTCTCGGCTGCATCCTANTGCCGGCNCGGGGCGGNGGGTGGCCGGCGG
CGGGCCGCGGTCATGCGGGTGGGGGCACACCCCTCGTACCTGTCACTGGGATGCAGACTC
TCGACATCCGAGTCCAAGCGCCAGGCCCCTCGGGCGCAGGCAGCTCACACCAAGAAGAGA
CTGTATTGCAGGGTGAAGAGTGGGCTCCCCGTGCCCCANAGCTGCACGCCCGGTCACAGA
ACACTTACGCCCGNCACCTGTTCCCGCAGGAGG
Restriction Sites NotI-NotI |
ACCN NM_002360
Insert Size 4000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002360.2, NP_002351.1
RefSeq Size 1581 bp
RefSeq ORF 471 bp
Locus ID 7975
UniProt ID O60675
Cytogenetics 7p22.3
Domains BRLZ, bZIP_Maf
Protein Families Druggable Genome, Transcription Factors
Summary The developmentally regulated expression of the globin genes depends on upstream regulatory elements termed locus control regions (LCRs). LCRs are associated with powerful enhancer activity that is mediated by the transcription factor NFE2 (nuclear factor erythroid-2). NFE2 recognition sites are also present in the gene promoters of 2 heme biosynthetic enzymes, porphobilinogen deaminase (PBGD; MIM 609806) and ferrochelatase (FECH; MIM 612386). NFE2 DNA-binding activity consists of a heterodimer containing an 18-kD Maf protein (MafF, MafG (MIM 602020), or MafK) and p45 (MIM 601490). Both subunits are members of the activator protein-1 superfamily of basic leucine zipper (bZIP) proteins (see MIM 165160). Maf homodimers suppress transcription at NFE2 sites.supplied by OMIM, Nov 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002360" in other vectors (6)
SKU Description Size Price
RC223543 MAFK (Myc-DDK-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) (MAFK) 10 ug
$225.00
RC223543L1 Lenti ORF clone of Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) (MAFK), Myc-DDK-tagged 10 ug
$525.00
RC223543L2 Lenti ORF clone of Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) (MAFK), mGFP tagged 10 ug
$525.00
RC223543L3 Lenti ORF clone of Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) (MAFK), Myc-DDK-tagged 10 ug
$525.00
RC223543L4 Lenti ORF clone of Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) (MAFK), mGFP tagged 10 ug
$525.00
RG223543 MAFK (tGFP-tagged) - Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) (MAFK) 10 ug
$425.00

file-alt Citations

Identification and characterization of a FOXA2-regulated transcriptional enhancer at a type 2 diabetes intronic locus that controls GCKR expression in liver cells
López Rodríguez, Kaminska, Lappalainen et al
Genome Med (2017) 9 (1), 63 DOI: 10.1186/s13073-017-0453-x
AI Summary: OriGene products, specifically the plasmids expressing human FOXA2 (SC122913), FOXA1 (SC118299), RXRA (SC118696), MAFK (SC108256), and the control vector pCMV6-XL5, were used to assess the role of these transcription factors in regulating the GCKR intronic enhancer activity in liver cells.
Snippet: plasmid (Promega) encoding the luciferase gene hRluc (Renilla reniformis) and plasmids expressing human FOXA2, FOXA1, RXRA, or MAFK or the control vector pCMV6-XL5 without TF insert (SC122913;SC118299;SC118696;SC108256;pCMV6-XL5;OriGene) ... All 6 versions Cite SaveSaving
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products