OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

S100A4 (NM_002961) Human Untagged Clone

Be the first to review this product
SKU
SC118301
S100A4 (untagged)-Human S100 calcium binding protein A4 (S100A4), transcript variant 1
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "S100A4 or NM_002961"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol S100A4
Synonyms 18A2; 42A; CAPL; FSP1; MTS1; P9KA; PEL98
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_002961 edited
ATGGCGTGCCCTCTGGAGAAGGCCCTGGATGTGATGGTGTCCACCTTCCACAAGTACTCG
GGCAAAGAGGGTGACAAGTTCAAGCTCAACAAGTCAGAACTAAAGGAGCTGCTGACCCGG
GAGCTGCCCAGCTTCTTGGGGAAAAGGACAGATGAAGCTGCTTTCCAGAAGCTGATGAGC
AACTTGGACAGCAACAGGGACAACGAGGTGGACTTCCAAGAGTACTGTGTCTTCCTGTCC
TGCATCGCCATGATGTGTAACGAATTCTTTGAAGGCTTCCCAGATAAGCAGCCCAGGAAG
AAATGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002961 unedited
CACGAGGCTTCTTCTTTCTTGGTTTGATCCTGACTGCTGTCATGGCGTGCCCTCTGGAGA
AGGCCCTGGATGTGATGGTGTCCACCTTCCACAAGTACTCGGGCAAAGAGGGTGACAAGT
TCAAGCTCAACAAGTCAGAACTAAAGGAGCTGCTGACCCGGGAGCTGCCCAGCTTCTTGG
GGAAAAGGACAGATGAAGCTGCTTTCCAGAAGCTGATGAGCAACTTGGACAGCAACAGGG
ACAACGAGGTGGACTTCCAAGAGTACTGTGTCTTCCTGTCCTGCATCGCCATGATGTGTA
ACGAATTCTTTGAAGGCTTCCCAGATAAGCAGCCCAGGAAGAAATGAAAACTCCTCTGAT
GTGGTTGGGGGGTCTGCCAGCTGGGGCCCTCCCTGTCGCCAGTGGGCACTTTTTTTTTTC
CACCCTGGCTCCTTCAGACACGTGCTTGATGCTGAGCAAGTTCAATAAAGATTCTTGGAA
GTTTTGN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002961 unedited
GGGTCTTTCTTCCANATTTTTTGTACTTGCTCACATCAAGCACGTGTCTGAAGGACCAGG
GTGGAAAAAAAAAATGCCCACTGGCGACAGGGAGGGCCCCAGCTGGCAGACCCCCCAACC
ACATCAGAGGAGTTTTCATTTCTTCCTGGGCTGCTTATCTGGGAAGCCTTCAAAGAATTC
GTTACACATCATGGCGATGCAGGACAGGAAGACACAGTACTCTTGGAAGTCCACCTCGTT
GTCCCTGTTGCTGTCCAAGTTGCTCATCAGCTTCTGGAAAGCAGCTTCATCTGTCCTTTT
CCCCAAGAAGCTGGGCAGCTCCCGGGTCAGCAGCTCCTTTAGTTCTGACTTGTTGAGCTT
GAACTTGTCACCCTCTTTGCCCGAGTACTTGTGGAAGGTGGACACCATCACATCCAGGGC
CTTCTCCAGAGGGCACGCCATGACAGCAGTCAGGATCAAACCAAGAAAGAAGAAGCCTCG
TGCCGAATTCGCGGCCGCCCTATAGTGAGTCGTATTACAAAATTCTGACGGTTCACTAAA
CGAGCTCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAACGGG
GCGGGGTTATTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCA
TTGACGTCAATGGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCC
ATTGGTGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATGTA
CTGCCAAGTANGAAAGTCCCCGTAGGTCATGTACTGGGCATAAATGCCAGCGGGCCATNT
ACCGTCATTGACGTCATAGGGGGCGGNACTNGCATATGATACACTTGATGTACTGNNCAG
TGGGCAGTNTACCCGTAATACTCN
Restriction Sites NotI-NotI |
ACCN NM_002961
Insert Size 550 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002961.2, NP_002952.1
RefSeq Size 512 bp
RefSeq ORF 306 bp
Locus ID 6275
UniProt ID P26447
Cytogenetics 1q21.3
Domains EFh, S_100
Summary The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in motility, invasion, and tubulin polymerization. Chromosomal rearrangements and altered expression of this gene have been implicated in tumor metastasis. Multiple alternatively spliced variants, encoding the same protein, have been identified. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) has an alternate 5' UTR, compared to variant 2. Both variants 1 and 2 encode the same isoform.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002961" in other vectors (6)
SKU Description Size Price
RC203035 S100A4 (Myc-DDK-tagged)-Human S100 calcium binding protein A4 (S100A4), transcript variant 1 10 ug
$289.00
RC203035L1 Lenti ORF clone of Human S100 calcium binding protein A4 (S100A4), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC203035L2 Lenti ORF clone of Human S100 calcium binding protein A4 (S100A4), transcript variant 1, mGFP tagged 10 ug
$450.00
RC203035L3 Lenti ORF clone of Human S100 calcium binding protein A4 (S100A4), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC203035L4 Lenti ORF clone of Human S100 calcium binding protein A4 (S100A4), transcript variant 1, mGFP tagged 10 ug
$450.00
RG203035 S100A4 (tGFP-tagged) - Human S100 calcium binding protein A4 (S100A4), transcript variant 1 10 ug
$489.00

file-alt Citations

S100A4 Knockout Sensitizes Anaplastic Thyroid Carcinoma Cells Harboring BRAFV600E/Mt to Vemurafenib
Jiao, Zhang, Xu et al
Cell. Physiol. Biochem. (2018) 49 (3), 1143-1162 DOI: 10.1159/000493296
AI Summary: OriGene products, specifically the pCMV6-XL5-S100A4 cDNA expression plasmid, its control plasmid pCMV6-XL5, and the pCMV6-HA-Akt expression vector, were used to manipulate S100A4 and AKT expression in anaplastic thyroid carcinoma cells, enabling the study of their roles in cell survival, proliferation, and response to vemurafenib treatment.
Snippet: The pCMV6-XL5-S100A4 cDNA (abbreviated as pCMV-S100A4) expression plasmid and control plasmid pCMV6-XL5 (pCMV) were purchased from OriGene Technologies. pCMV6-HA-Akt expression vectors were constructed from OriGene Technologies
S100A4 suppresses cancer stem cell proliferation via interaction with the IKK/NF-κB signaling pathway
Zhu, Zhou, Zhou et al
BMC Cancer (2018) 18 (1), 763 DOI: 10.1186/s12885-018-4563-7
AI Summary: OriGene’s pCMV6-XL5 plasmid was used to overexpress S100A4 in bladder cancer stem cells, enabling the study of S100A4’s role in regulating cell proliferation and the IKK/NF-κB signaling pathway.
Snippet: …Full length of S100A4 gene were inserted into a vector plasmid pCMV6-XL5 (OriGene Technologies) Cached;GAPDH. …Full length of S100A4 gene were inserted into a vector plasmid pCMV6-XL5 (OriGene Technologies) Cached
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products