OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SNRPD3 (NM_004175) Human Untagged Clone

Be the first to review this product
SKU
SC117501
SNRPD3 (untagged)-Human small nuclear ribonucleoprotein D3 polypeptide 18kDa (SNRPD3)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA381847 SNRPD3 Rabbit polyclonal Antibody
100 ul
$410.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SNRPD3 or NM_004175"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SNRPD3
Synonyms Sm-D3; SMD3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC117501 sequence for NM_004175 edited (data generated by NextGen Sequencing)
ATGTCTATTGGTGTGCCGATTAAAGTACTGCATGAGGCCGAGGGCCACATTGTGACATGT
GAGACGAACACCGGTGAGGTATATCGGGGGAAGCTCATTGAAGCAGAGGACAACATGAAC
TGCCAGATGTCCAACATCACAGTCACATACAGAGATGGCCGAGTGGCACAGCTGGAGCAG
GTATACATCCGTGGCAGCAAAATCCGCTTTCTGATTTTGCCTGACATGCTGAAGAACGCA
CCCATGTTAAAGAGCATGAAAAATAAAAACCAAGGCTCAGGGGCTGGCCGAGGAAAAGCT
GCCATTCTCAAGGCCCAAGTGGCCGCAAGAGGAAGAGGACGTGGAATGGGACGTGGAAAC
ATCTTTCAAAAGCGAAGATAA

Clone variation with respect to NM_004175.3
303 t=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004175 unedited
GTTCGAATTTGTATACGACTCCTATAGGCGGCCCGCGAATTCGCACGAGGCTCACGCCTT
CGCCGTAGCATCTTTCGCAGCGGACCGAAGAGAAGAAAGTAGGCCAGAGCCGAACTCTCT
TCCTGCCAAGATGTCTATTGGTGTGCCGATTAAAGTACTGCATGAGGCCGAGGGCCACAT
TGTGACATGTGAGACGAACACCGGTGAGGTATATCGGGGGAAGCTCATTGAAGCAGAGGA
CAACATGAACTGCCAGATGTCCAACATCACAGTCACATACAGAGATGGCCGAGTGGCACA
GCTGGAGCAGGTATACATCCGTGGCAGCAAAATCCGCTTTCTGATTTTGCCTGACATGCT
GAAGAACGCACCCATGTTAAAGAGCATGAAAAATAAAAACCAAGGCTCAGGGGCTGGCCG
AGGAAAAGCTGCCATTCTCAAGGCCCAAGTGGCCGCAAGAGGAAGAGGACGTGGAATGGG
ACGTGGAAACATCTTTCAAAAGCGAAGATAATTTTCTAAGTTGAACAGAACTTTGTCCTT
TTTTCTTTCAGGTTATCTGAGTTCATTGGAGTGGGTGCTTGTGCATATATGCTAGGTATC
TTTTGCCATCTTTCTCTTTAGATCAGGGGAAATGTTTAAGCTAAATAAATCTGGGGGGTT
TTTTGTTCTGTTTTGTTTTGTTNTCTTTGAGAAAATAAGGACTNTGTGTTCATTTGAAGT
TTGCTTTGGCTAAATTTTGACACCCTGNNGGGATGTCCTGGGAGAATGCCAGTACTTTGA
AATAGCACAGCTATTGATGAGATTNTAAGCTGCTGTTCCTGGCCAGTTGCAGGNTAGCCC
CCAAAAAGTTACCTTGGNAAAGCTCCGAGACCACANGATGTGTCTCATTCTCTTCGACCA
GCCCATAGGTGNCACTTTGTTAGTAA
Restriction Sites NotI-NotI |
ACCN NM_004175
Insert Size 4000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004175.3, NP_004166.1
RefSeq Size 1385 bp
RefSeq ORF 381 bp
Locus ID 6634
UniProt ID P62318
Cytogenetics 22q11.23
Domains Sm
Protein Families Druggable Genome
Protein Pathways Spliceosome, Systemic lupus erythematosus
Summary This gene encodes a core component of the spliceosome, which is a nuclear ribonucleoprotein complex that functions in pre-mRNA splicing. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jul 2013
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_004175" in other vectors (4)
SKU Description Size Price
RC201255 SNRPD3 (Myc-DDK-tagged)-Human small nuclear ribonucleoprotein D3 polypeptide 18kDa (SNRPD3) 10 ug
$150.00
RC201255L3 Lenti-ORF clone of SNRPD3 (Myc-DDK-tagged)-Human small nuclear ribonucleoprotein D3 polypeptide 18kDa (SNRPD3) 10 ug
$450.00
RC201255L4 Lenti-ORF clone of SNRPD3 (mGFP-tagged)-Human small nuclear ribonucleoprotein D3 polypeptide 18kDa (SNRPD3) 10 ug
$450.00
RG201255 SNRPD3 (tGFP-tagged) - Human small nuclear ribonucleoprotein D3 polypeptide 18kDa (SNRPD3) 10 ug
$350.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products