OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ELK1 (NM_005229) Human Untagged Clone

Be the first to review this product
SKU
SC116858
ELK1 (untagged)-Human ELK1, member of ETS oncogene family (ELK1), transcript variant 2
  $686.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ELK1 or NM_005229"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ELK1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_005229, the custom clone sequence may differ by one or more nucleotides


ATGGACCCATCTGTGACGCTGTGGCAGTTTCTGCTGCAGCTGCTGAGAGAGCAAGGCAATGGCCACATCA
TCTCCTGGACTTCACGGGATGGTGGTGAATTCAAGCTGGTGGATGCAGAGGAGGTGGCCCGGCTGTGGGG
GCTACGCAAGAACAAGACCAACATGAATTACGACAAGCTCAGCCGGGCCTTGCGGTACTACTATGACAAG
AACATCATCCGCAAGGTGAGCGGCCAGAAGTTCGTCTACAAGTTTGTGTCCTACCCTGAGGTCGCAGGGT
GCTCCACTGAGGACTGCCCGCCCCAGCCAGAGGTGTCTGTTACCTCCACCATGCCAAATGTGGCCCCTGC
TGCTATACATGCCGCCCCAGGGGACACTGTCTCTGGAAAGCCAGGCACACCCAAGGGTGCAGGAATGGCA
GGCCCAGGCGGTTTGGCACGCAGCAGCCGGAACGAGTACATGCGCTCGGGCCTCTATTCCACCTTCACCA
TCCAGTCTCTGCAGCCGCAGCCACCCCCTCATCCTCGGCCTGCTGTGGTGCTCCCCAGTGCAGCTCCTGC
AGGGGCAGCAGCGCCCCCCTCGGGGAGCAGGAGCACCAGTCCAAGCCCCTTGGAGGCCTGTCTGGAGGCT
GAAGAGGCCGGCTTGCCTCTGCAGGTCATCCTGACCCCGCCCGAGGCCCCAAACCTGAAATCGGAAGAGC
TTAATGTGGAGCCGGGTTTGGGCCGGGCTTTGCCCCCAGAAGTGAAAGTAGAAGGGCCCAAGGAAGAGTT
GGAAGTTGCGGGGGAGAGAGGGTTTGTGCCAGAAACCACCAAGGCCGAGCCAGAAGTCCCTCCACAGGAG
GGCGTGCCAGCCCGGCTGCCCGCGGTTGTTATGGACACCGCAGGGCAGGCGGGCGGCCATGCGGCTTCCA
GCCCTGAGATCTCCCAGCCGCAGAAGGGCCGGAAGCCCCGGGACCTAGAGCTTCCACTCAGCCCGAGCCT
GCTAGGTGGGCCGGGACCCGAACGGACCCCAGGATCGGGAAGTGGCTCCGGCCTCCAGGCTCCGGGGCCG
GCGCTGACCCCATCCCTGCTTCCTACGCATACATTGACCCCGGTGCTGCTGACACCCAGCTCGCTGCCTC
CTAGCATTCACTTCTGGAGCACCCTGAGTCCCATTGCGCCCCGTAGCCCGGCCAAGCTCTCCTTCCAGTT
TCCATCCAGTGGCAGCGCCCAGGTGCACATCCCTTCTATCAGCGTGGATGGCCTCTCGACCCCCGTGGTG
CTCTCCCCAGGGCCCCAGAAGCCATGA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_005229 unedited
ACAAATTTGTAATACGACTCACTTATAGGGCGGCCGCGAATCGGCACGAGGCCAACATTG
CCAACGCCACCGCCACGCTACACACAGCCTCAACTTTCAGGAGACCCGTCCGTGGCCTTA
TTTATTCCACCCTTCCTGTACATCGTAGCGAATCAATCCGTGGCGCCGCACTCCTCCGCA
TCCCTCTTTAACAGTACCCCTGGGATGGCGTGAGCACTCCCCCAGCGATGGACCCATCTG
TGACGCTGTGGCAGTTTCTGCTGCAGCTGCTGAGAGAGCAAGGCAATGGCCACATCATCT
CCTGGACTTCACGGGATGGTGGTGAATTCAAGCTGGTGGATGCAGAGGAGGTGGCCCGGC
TGTGGGGGCTACGCAAGAACAAGACCAACATGAATTACGACAAGCTCAGCCGGGCCTTGC
GGTACTACTATGACAAGAACATCATCCGCAAGGTGAGCGGCCAGAAGTTCGTCTACAAGT
TTGTGTCCTACCCTGAGGTCGCAGGGTGCTCCACTGAGGACTGCCCGCCCCAGCCAGAGG
TGTCTGTTACCTCCACCATGCCAAATGTGGCCCCTGCTGCTATACATGCCGCCCCAGGGG
ACACTGTCTCTGGAAAGCCAGGCACACCCAAGGGTGCAGGAATGGCAGGCCCAGGCGGTT
TGGCACGCAGCAACCGGAACGAGTACATGCGCTCGGGCCTCTATTCCACCTTCACCATNC
AGTCTCTGCAGCCGCAGCCACCCCCTCATCCTCGGCCTGCTGTGGTGCTCCCCAGTGCAG
CTCCTGCAGGGGCAGCAGCGCCCCCCTCGGNGAGCAGGAGCACCAGTCCAAGCCCCTTTG
GAGCCTGTCTGGNAGCTGAAGAGGCCGCTTGCCTCTGCAGGTCATCCTGACCCCGCCCGA
GCCCCAACCTNGAATCGNAGAAGCTATGTGNGACCCGGNTTGGGCCGGGCTTGCCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005229 unedited
NNTTTTAGCTTGNNACCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTCACTTTGAAAAAATATATTTACAGGAACAATTCCCCATTCTTTGGGACTTTT
TAAAAAAAAAAAGGTCCATTTTGGGGAAGTAAAACAAACAGTGGAGACGAGTGTAGCACT
GTCCCCCAAATCACCAACCCCCAGGTCCCAAGGCCTGGGCTGGGCCAGCGCTAACAGGTG
AGCCCAGGAGTCTTTTGAACCCACTCTTTTTTGCCTAAAATAAAGACAGGACAGGCTTTA
TGTCCCCCATTCCTCCCTCCCAACTCCAGGGACATTGAAAGGGTCCTTTGTACCCGCCCG
CAGGAAATTGGGGGGCTGGGAGGGAGGGAACTGAAAATTCATGTTTGGTATCAAAAATAA
ACACTTGGAGTGGGGGAGGCGGCAGGAAAATTCCCCCCCAAATCCCTTCCTTCCCACCCA
CCCCACCAAATATAGGAAGAGATGACTCCCTCTCCCCTATTGAAAAGCCCCATTTAAAAA
TAGATTATACTATCAAAATGGCAGCGGGGGAGAGACAGGGAGACCTGGAGTACTGGCTGG
AGGGGCCCCCCAGACGGGGACCACCCCCCAAAAAAACCCTCCATTGGGAGGAAACAGGCA
GGACCCCAGGGAGGTTGGCAGACAAAGGAATGGCTTCTCAGGGGGAAGAACAAAAGGGAC
ATTCCTCCCTGGCCAAAAAGTTGGTTGAAAAGGATAAGCTGTCTGAGAGAAAGGTTGNGG
AGGGTGGAATTTCTATTCCAAGGGTGTGATTCTTCCTTGGCCAAGACTCCCAACCCATTA
AATGGTACAAATTCTTCTTGGACCCCTGAGTATGCCCAGAAAATATAAAACAACAAACTA
ACTTTTTACTTACATTCAAAAACGCGACAAGGCTCT
Restriction Sites NotI-NotI |
ACCN NM_005229
Insert Size 2800 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation no
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005229.2, NP_005220.1
RefSeq Size 2828 bp
RefSeq ORF 1287 bp
Locus ID 2002
UniProt ID P19419
Cytogenetics Xp11.23
Domains ETS
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Endometrial cancer, ErbB signaling pathway, Focal adhesion, GnRH signaling pathway, Insulin signaling pathway, MAPK signaling pathway, Prion diseases
Summary This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum response element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is a nuclear target for the ras-raf-MAPK signaling cascade. This gene produces multiple isoforms by using alternative translational start codons and by alternative splicing. Related pseudogenes have been identified on chromosomes 7 and 14. provided by RefSeq, Mar 2012
Transcript Variant: This variant (2, also known as 5'UTR short or 5'UTRS) lacks an alternate exon in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode isoform a. Delayed translational reinitiation from an alternative downstream start codon, AUG sElk-1, can also result in a shorter isoform (sELK-1), as described in PMID:22354998.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_005229" in other vectors (6)
SKU Description Size Price
RC208921 ELK1 (Myc-DDK-tagged)-Human ELK1, member of ETS oncogene family (ELK1), transcript variant 2 10 ug
$686.00
RC208921L1 Lenti ORF clone of Human ELK1, member of ETS oncogene family (ELK1), transcript variant 2, Myc-DDK-tagged 10 ug
$986.00
RC208921L2 Lenti ORF clone of Human ELK1, member of ETS oncogene family (ELK1), transcript variant 2, mGFP tagged 10 ug
$986.00
RC208921L3 Lenti ORF clone of Human ELK1, member of ETS oncogene family (ELK1), transcript variant 2, Myc-DDK-tagged 10 ug
$986.00
RC208921L4 Lenti ORF clone of Human ELK1, member of ETS oncogene family (ELK1), transcript variant 2, mGFP tagged 10 ug
$986.00
RG208921 ELK1 (tGFP-tagged) - Human ELK1, member of ETS oncogene family (ELK1), transcript variant 2 10 ug
$886.00

file-alt Citations

Aberrant expression of NKL homeobox genes HMX2 and HMX3 interferes with cell differentiation in acute myeloid leukemia
Nagel, Pommerenke, Meyer et al
PLoS One (2020) 15 (10), e0240120 DOI: 10.1371/journal.pone.0240120
Cited by 9
AI Summary: OriGene contributed expression constructs for ELK1 (SC116858), ETS1 (SC125359), EPX (RC218959), HMX2 (SC303658), and SP1 (SC101137), which were used to investigate the roles of these genes in the regulation and function of HMX2 and HMX3 in acute myeloid leukemia.
Snippet: Qiagen (Hilden, Germany). Expression constructs for ELK1 (SC116858), ETS1 (SC125359), EPX (RC218959), HMX2 (SC303658) and SP1 (SC101137) were purchased from Origene (Wiesbaden, Germany). SiRNAs (80 pmol Cached
FigureFigureFigure
Histone deacetylase 6 (HDAC6) deacetylates extracellular signal-regulated kinase 1 (ERK1) and thereby stimulates ERK1 activity
Wu, Xiang, Zhang et al
J. Biol. Chem. (2017)
AI Summary: OriGene's pCMV-ELK1 plasmid (SC116858) was used in this study to express human ELK1, enabling investigation of ERK1 activity toward its substrate and thereby supporting the analysis of HDAC6-mediated regulation of ERK1 function.
Snippet: pCMV- ELK1 purchased from Origene (SC116858) contains untagged human ELK1 (member of ETS oncogene family (ELK1), transcript variant 2, NM_005229.2). The construct was made by inserting the cDNA of ELK1 into the Not I site of the pCMV6-XL4 vector
Regulation of the miRNA-200b by transcriptional regulators PEA3 and ELK-1 affects expression of Pin1 to control anoikis
Zhang, Zhang, Gao et al
J. Biol. Chem. (2013)
AI Summary: OriGene's PCMV plasmids were used to express Pin1, PEA3, and ELK-1 in this study, enabling the authors to investigate how these transcriptional regulators and Pin1 impact miRNA-200b expression and anoikis in cancer cells.
Snippet: The plasmid for expression of miRNA-200b was pGCsilencer (GeneChem). The plasmid for expression of Pin1, PEA3, and ELK-1 was PCMV (Origene, NY, USA). The plasmid for expression of SUMO1 with the FLAG tag was kindly provided by Professor Jinke Cheng
The ETS domain transcription factor ELK1 directs a critical component of growth signaling by the androgen receptor in prostate cancer cells
Patki, Chari, Sivakumaran et al
J. Biol. Chem. (2013) 288 (16), 11047-65 DOI: 10.1074/jbc.M112.438473
Cited by 1
AI Summary: OriGene contributed to this study by providing the human full-length ELK1 and ELK3 expression plasmids (in pCMV plasmid), which were used to investigate the roles of these transcription factors in androgen receptor signaling in prostate cancer cells.
Snippet: The AR expression plasmid (pSG5 vector) was a kind gift from Dr. Lirim Shemshedini. The expression plasmids for human full-length ELK1 and ELK3 in the pCMV plasmid were purchased from OriGene (Rockville, MD). The
The homeobox gene CHX10/VSX2 regulates RdCVF promoter activity in the inner retina
Reichman, Kalathur, Lambard et al
Hum Mol Genet (2010) 19 (2), 250-61 DOI: 10.1093/hmg/ddp484
Cited by 48
AI Summary: In this study, OriGene products—including the human CHX10/VSX2 Myc-DDK-tagged ORF cDNA clone and the mouse Nxnl1 cDNA clone—were used to investigate how specific transcription factors regulate the Nxnl1 (RdCVF) promoter, helping to identify CHX10/VSX2 as a key regulator of RdCVF expression in the inner retina.
Role of ETS transcription factors in the hypoxia-inducible factor-2 target gene selection
Aprelikova, Wood, Tackett et al
Cancer Res (2006) 66 (11), 5641-7 DOI: 10.1158/0008-5472.CAN-05-3345
AI Summary: In this study, OriGene products including HIF-1alpha and HIF-2alpha shRNA lentiviral particles were used for RNA interference-mediated knockdown to investigate the specific roles of HIF-1alpha and HIF-2alpha in regulating hypoxia-responsive genes.
Showing 1-6 of 7 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products