OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ENY2 (NM_020189) Human Untagged Clone

Be the first to review this product
SKU
SC113213
ENY2 (untagged)-Human enhancer of yellow 2 homolog (Drosophila) (ENY2), transcript variant 1
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA359250 ENY2 Antibody - N-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ENY2 or NM_020189"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ENY2
Synonyms DC6; e(y)2; Sus1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC113213 sequence for NM_020189 edited (data generated by NextGen Sequencing)
ATGGTGGTTAGCAAGATGAACAAAGATGCGCAGATGAGAGCAGCGATTAACCAAAAGTTG
ATAGAAACTGGAGAAAGAGAACGCCTCAAAGAGTTGCTGAGAGCTAAATTAATTGAATGT
GGCTGGAAGGATCAGTTGAAGGCACACTGTAAAGAGGTAATTAAAGAAAAAGGACTAGAA
CACGTTACTGTTGATGACTTGGTGGCTGAAATCACTCCAAAAGGCAGAGCCCTGGTACCT
GACAGTGTAAAGAAGGAGCTCCTACAAAGAATAAGAACATTCCTTGCTCAGCATGCCAGC
CTTTAA

Clone variation with respect to NM_020189.5
5' Read Nucleotide Sequence
>OriGene 5' read for NM_020189 unedited
GTTCAAATTTATGTATACGACTCACTATTAGGGCGGCCGCGATTCGGCACGAGGAAGAGT
GTGGTAGGTAACGGTCCTCGCGCAGGGTCATTTCGTCGCTGGGAAGGGACGGCCCTCGCC
CGCGGTGATGGTGGTTAGCAAGATGAACAAAGATGCGCAGATGAGAGCAGCGATTAACCA
AAAGTTGATAGAAACTGGAGAAAGAGAACGCCTCAAAGAGTTGCTGAGAGCTAAATTAAT
TGAATGTGGCTGGAAGGATCAGTTGAAGGCACACTGTAAAGAGGTAATTAAAGAAAAAGG
ACTAGAACACGTTACTGTTGATGACTTGGTGGCTGAAATCACTCCAAAAGGCAGAGCCCT
GGTACCTGACAGTGTAAAGAAGGAGCTCCTACAAAGAATAAGAACATTCCTTGCTCAGCA
TGCCAGCCTTTAAGATTGAATTAGATTGTGTTGTTGTGGTTTTATTTCTGAAAGTAAAAC
TTGCCATAAATTAGAAAACAATTTCCCAAAATAAAATCCTTTTTTGTATGATGGTATACA
GTTTTCAGTAATGATGTATACATTGTATTGATTTTTTTCCCTAAATGTGTTATTTTAATA
AATATCTCATGAATGAGTTTGAAGTTTGCTTGGATTTTGAAATGAATGGGACTTTGTCTT
TATTACTAATTCACCAAATTTGTTGAGCGCAAAAGCAATTAATGTAGTTTAAGTATTTAG
TATGTACAGCTCTCTGTGTTAACAGCTGAGAAGTAAGCAACCTTTTCTGACTGCATATGC
TGTATTCCTCTTTTGAGTCCCCATAATATTTTATAAATTGTAATGCCCCATCTTGTACTA
CAGNTGCCTTATTCGNATTGTTTATAAACTTTGAGGGGTAGGACTGGNGTCTTACTCATC
TTTATTGGGCCTTNCCTTATGCTTCAAAGAATTA
Restriction Sites NotI-NotI |
ACCN NM_020189
Insert Size 1380 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020189.4, NP_064574.1
RefSeq Size 586 bp
RefSeq ORF 306 bp
Locus ID 56943
UniProt ID Q9NPA8
Cytogenetics 8q23.1
Summary Involved in mRNA export coupled transcription activation by association with both the TREX-2 and the SAGA complexes. The transcription regulatory histone acetylation (HAT) complex SAGA is a multiprotein complex that activates transcription by remodeling chromatin and mediating histone acetylation and deubiquitination. Within the SAGA complex, participates in a subcomplex that specifically deubiquitinates both histones H2A and H2B. The SAGA complex is recruited to specific gene promoters by activators such as MYC, where it is required for transcription. Required for nuclear receptor-mediated transactivation (PubMed:18206972, PubMed:21746879). As a component of the TREX-2 complex, involved in the export of mRNAs to the cytoplasm through the nuclear pores (PubMed:23591820).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longer protein (isoform 1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_020189" in other vectors (4)
SKU Description Size Price
RC203231 ENY2 (Myc-DDK-tagged)-Human enhancer of yellow 2 homolog (Drosophila) (ENY2), transcript variant 1 10 ug
$150.00
RC203231L3 Lenti ORF clone of Human enhancer of yellow 2 homolog (Drosophila) (ENY2), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC203231L4 Lenti ORF clone of Human enhancer of yellow 2 homolog (Drosophila) (ENY2), transcript variant 1, mGFP tagged 10 ug
$450.00
RG203231 ENY2 (tGFP-tagged) - Human enhancer of yellow 2 homolog (Drosophila) (ENY2), transcript variant 1 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products