OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ULBP3 (NM_024518) Human Untagged Clone

Be the first to review this product
SKU
SC112194
ULBP3 (untagged)-Human UL16 binding protein 3 (ULBP3)
  $450.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ULBP3 or NM_024518"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ULBP3
Synonyms N2DL-3; NKG2DL3; RAET1N
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_024518, the custom clone sequence may differ by one or more nucleotides


ATGGCAGCGGCCGCCAGCCCCGCGATCCTTCCGCGCCTCGCGATTCTTCCGTACCTGCTATTCGACTGGT
CCGGGACGGGGCGGGCCGACGCTCACTCTCTCTGGTATAACTTCACCATCATTCATTTGCCCAGACATGG
GCAACAGTGGTGTGAGGTCCAGAGCCAGGTGGATCAGAAGAATTTTCTCTCCTATGACTGTGGCAGTGAC
AAGGTCTTATCTATGGGTCACCTAGAAGAGCAGCTGTATGCCACAGATGCCTGGGGAAAACAACTGGAAA
TGCTGAGAGAGGTGGGGCAGAGGCTCAGACTGGAACTGGCTGACACTGAGCTGGAGGATTTCACACCCAG
TGGACCCCTCACGCTGCAGGTCAGGATGTCTTGTGAGTGTGAAGCCGATGGATACATCCGTGGATCTTGG
CAGTTCAGCTTCGATGGACGGAAGTTCCTCCTCTTTGACTCAAACAACAGAAAGTGGACAGTGGTTCACG
CTGGAGCCAGGCGGATGAAAGAGAAGTGGGAGAAGGATAGCGGACTGACCACCTTCTTCAAGATGGTCTC
AATGAGAGACTGCAAGAGCTGGCTTAGGGACTTCCTGATGCACAGGAAGAAGAGGCTGGAACCCACAGCA
CCACCCACCATGGCCCCAGGCTTAGCTCAACCCAAAGCCATAGCCACCACCCTCAGTCCCTGGAGCTTCC
TCATCATCCTCTGCTTCATCCTCCCTGGCATCTGA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_024518 unedited
TATCCCCCGCCCGTTGNCGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGC
AGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCG
AATTCGGCACGAGGCGCTCCTGGTCTACAATGGCAGCGGCCGCCAGCCCCGCGATCCTTC
CGCGCCTCGCGATTCTTCCGTACCTGCTATTCGACTGGTCCGGGACGGGGCGGGCCGACG
CTCACTCTCTCTGGTATAACTTCACCATCATTCATTTGCCCAGACATGGGCAACAGTGGT
GTGAGGTCCAGAGCCAGGTGGATCAGAAGAATTTTCTCTCCTATGACTGTGGCAGTGACA
AGGTCTTATCTATGGGTCACCTAGAAGAGCAGCTGTATGCCACAGATGCCTGGGGAAAAC
AACTGGAAATGCTGAGAGAGGTGGGGCAGAGGCTCAGACTGGAACTGGCTGACACTGAGC
TGGAGGATTTCACACCCAGTGGACCCCTCACGCTGCAGGTCAGGATGTCTTGTGAGTGTG
AAGCCGATGGATACATCCGTGGATCTTGGCAGTTCAGCTTCGATGGACGGAAGTTCCTCC
TCTTTGACTCAAACAACAGAAAGTGGACAGTGGTTCACGCTGGAGCCCAGCGGATGAAAG
AGAAGTGGGAGAAAGATAGCGGACTGACCACCTTCTTCAAGATGGTCTCAATGAGAGACT
GCAAGAGCTGGCTTANGGACTTCCTGATGCACAGGAAGAAGAGGCTGGAACCCACAGCAC
CACCCCCATGGGCCCAGGCTTAGCTCAACCCAAGCCATAGCCACCACCCTCAGTCCCNTG
GAGCTTCTCATCATCCTCTGCTTCATCCTCCCTGGCATCTGAGAAGAGTCATTTAAAGTG
ACAGGTGGGAAGGTGATATCCAAGAGCCTCTGNTAGCCTGGGNCTGGNTCCTGCTCTNCC
TTCAGGNAGGCCCGCTGTCTCT
Restriction Sites NotI-NotI |
ACCN NM_024518
Insert Size 3500 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024518.1, NP_078794.1
RefSeq Size 735 bp
RefSeq ORF 735 bp
Locus ID 79465
UniProt ID Q9BZM4
Cytogenetics 6q25.1
Domains MHC_I
Protein Families Druggable Genome
Protein Pathways Natural killer cell mediated cytotoxicity
Summary The protein encoded by this gene is one of several related ligands of the KLRK1/NKG2D receptor, which is found in primary NK cells. Binding of these ligands to the receptor activates several signal transduction pathways, including the JAK2, STAT5, and ERK pathways. The encoded protein is expressed solubly and on the surface of many tumor cells, making it potentially an important target for therapeutics. provided by RefSeq, Nov 2015
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_024518" in other vectors (6)
SKU Description Size Price
RC219672 ULBP3 (Myc-DDK-tagged)-Human UL16 binding protein 3 (ULBP3) 10 ug
$450.00
RC219672L1 Lenti ORF clone of Human UL16 binding protein 3 (ULBP3), Myc-DDK-tagged 10 ug
$750.00
RC219672L2 Lenti ORF clone of Human UL16 binding protein 3 (ULBP3), mGFP tagged 10 ug
$750.00
RC219672L3 Lenti ORF clone of Human UL16 binding protein 3 (ULBP3), Myc-DDK-tagged 10 ug
$750.00
RC219672L4 Lenti ORF clone of Human UL16 binding protein 3 (ULBP3), mGFP tagged 10 ug
$750.00
RG219672 ULBP3 (tGFP-tagged) - Human UL16 binding protein 3 (ULBP3) 10 ug
$650.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products