OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

KCNIP4 (NM_025221) Human Untagged Clone

Be the first to review this product
SKU
SC111844
KCNIP4 (untagged)-Human Kv channel interacting protein 4 (KCNIP4), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA366183 KCNIP4 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "KCNIP4 or NM_025221"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KCNIP4
Synonyms CALP; KCHIP4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC111844 sequence for NM_025221 edited (data generated by NextGen Sequencing)
ATGAATGTGAGGAGGGTGGAAAGCATTTCGGCTCAGCTGGAGGAGGCCAGCTCTACAGGC
GGTTTCCTGTACGCTCAGAACAGCACCAAGCGCAGCATTAAAGAGCGGCTCATGAAGCTC
TTGCCCTGCTCAGCTGCCAAAACGTCGTCTCCTGCTATTCAAAACAGCGTGGAAGATGAA
CTGGAGATGGCCACCGTCAGGCATCGGCCCGAAGCCCTTGAGCTTCTGGAAGCCCAGAGC
AAATTTACCAAGAAAGAGCTTCAGATCCTTTACAGAGGATTTAAGAACGAATGCCCCAGT
GGTGTTGTTAATGAAGAAACCTTCAAAGAGATTTACTCGCAGTTCTTTCCACAGGGAGAC
TCTACAACATATGCACATTTTCTGTTCAATGCATTTGATACAGACCACAATGGAGCTGTG
AGTTTCGAGGATTTCATCAAAGGTCTTTCCATTTTGCTCCGGGGGACAGTACAAGAAAAA
CTCAATTGGGCATTTAATCTGTATGACATAAATAAAGATGGCTACATCACTAAAGAGGAA
ATGCTTGATATAATGAAAGCAATATACGATATGATGGGTAAATGTACATATCCTGTCCTC
AAAGAAGATGCTCCCAGACAACACGTTGAAACATTTTTTCAGAAAATGGACAAAAATAAA
GATGGGGTTGTTACCATAGATGAGTTCATTGAAAGCTGCCAAAAAGATGAAAACATAATG
CGCTCCATGCAGCTCTTTGAAAATGTGATTTAA

Clone variation with respect to NM_025221.5
210 t=>c;288 t=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_025221 unedited
NGTCAACTTTTGTATACGACTCACTATAGGGCGGCCGCGAATCGGCACGAGGGCGGCGGT
GCGCTCCCGTGCAGACCCGTGGACAGACGCCCCTGGCCGGTGGACTCTCGAGTCTCGCTT
CTGCACCCTGCGTCCCCAGACATGAATGTGAGGAGGGTGGAAAGCATTTCGGCTCAGCTG
GAGGAGGCCAGCTCTACAGGCGGTTTCCTGTACGCTCAGAACAGCACCAAGCGCAGCATT
AAAGAGCGGCTCATGAAGCTCTTGCCCTGCTCAGCTGCCAAAACGTCGTCTCCTGCTATT
CAAAACAGCGTGGAAGATGAACTGGAGATGGCCACCGTCAGGCATCGGCCCGAAGCCCTT
GAGCTTCTGGAAGCCCAGAGCAAATTTACCAAGAAAGAGCTTCAGATCCTTTACAGAGGA
TTTAAGAACGAATGCCCCAGTGGTGTTGTTAATGAAGAAACCTTCAAAGAGATTTACTCG
CAGTTCTTTCCACAGGGAGACTCTACAACATATGCACATTTTCTGTTCAATGCATTTGAT
ACAGACCACAATGGAGCTGTGAGTTTCGAGGATTTCATCAAAGGTCTTTCCATTNTGCTC
CGGNGGACAGTACAAGAAAAACTCAATTGGGCATTTAATCTGTATGACATAAATAAAGAT
GGCTACATCACTAAAGAGGAAATGCTTGATATAATGAAAGCAATATACGATATGATGGGT
AAATGTACATATCCTGTCCTCANAGAAGATGCTCCCAGACCACACGTTGAAACATTNTTT
CAGAANATGGACCAAAATAAGATGGGGGTTGTTACCATAGCATGAAGTTCATTGGAAAGC
TGCCCAAAAAGATGAAAACATAATGCGCTCCATGCAGCTCTTTGAAATGTGATTTAACTG
TCAAATAGATC
Restriction Sites NotI-NotI |
ACCN NM_025221
Insert Size 2340 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_025221.4, NP_079497.2
RefSeq Size 1556 bp
RefSeq ORF 753 bp
Locus ID 80333
UniProt ID Q6PIL6
Cytogenetics 4p15.31-p15.2
Domains EFh
Protein Families Druggable Genome, Ion Channels: Other
Summary This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. This protein member also interacts with presenilin. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) encodes the longest isoform (1, also known as KCHIP4.1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_025221" in other vectors (4)
SKU Description Size Price
RC211488 KCNIP4 (Myc-DDK-tagged)-Human Kv channel interacting protein 4 (KCNIP4), transcript variant 1 10 ug
$300.00
RC211488L3 Lenti ORF clone of Human Kv channel interacting protein 4 (KCNIP4), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC211488L4 Lenti ORF clone of Human Kv channel interacting protein 4 (KCNIP4), transcript variant 1, mGFP tagged 10 ug
$600.00
RG211488 KCNIP4 (tGFP-tagged) - Human Kv channel interacting protein 4 (KCNIP4), transcript variant 1 10 ug
$500.00

file-alt Citations

Specific effects of KChIP3/calsenilin/DREAM, but not KChIPs 1, 2 and 4, on calcium signalling and regulated secretion in PC12 cells
Venn, Haynes, Burgoyne
Biochem J (2008) 413 (1), 71-80 DOI: 10.1042/BJ20080441
AI Summary: OriGene products, specifically the KChIP1, KChIP2, KChIP3, and KChIP4 expression plasmids, were used in this study to compare the functional effects of different KChIP isoforms on calcium signaling and secretion in PC12 cells.
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products