OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ephrin A4 (EFNA4) (NM_005227) Human Untagged Clone

Be the first to review this product
SKU
SC111624
EFNA4 (untagged)-Human ephrin-A4 (EFNA4), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA367563 EFNA4 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ephrin A4 or NM_005227"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Ephrin A4
Synonyms EFL4; EPLG4; LERK4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_005227, the custom clone sequence may differ by one or more nucleotides


ATGCGGCTGCTGCCCCTGCTGCGGACTGTCCTCTGGGCCGCGTTCCTCGGCTCCCCTCTGCGCGGGGGCT
CCAGCCTCCGCCACGTAGTCTACTGGAACTCCAGTAACCCCAGGTTGCTTCGAGGAGACGCCGTGGTGGA
GCTGGGCCTCAACGATTACCTAGACATTGTCTGCCCCCACTACGAAGGCCCAGGGCCCCCTGAGGGCCCC
GAGACGTTTGCTTTGTACATGGTGGACTGGCCAGGCTATGAGTCCTGCCAGGCAGAGGGCCCCCGGGCCT
ACAAGCGCTGGGTGTGCTCCCTGCCCTTTGGCCATGTTCAATTCTCAGAGAAGATTCAGCGCTTCACACC
CTTCTCCCTCGGCTTTGAGTTCTTACCTGGAGAGACTTACTACTACATCTCGGTGCCCACTCCAGAGAGT
TCTGGCCAGTGCTTGAGGCTCCAGGTGTCTGTCTGCTGCAAGGAGAGGAAGTCTGAGTCAGCCCATCCTG
TTGGGAGCCCTGGAGAGAGTGGCACATCAGGGTGGCGAGGGGGGGACACTCCCAGCCCCCTCTGTCTCTT
GCTATTACTGCTGCTTCTGATTCTTCGTCTTCTGCGAATTCTGTGA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_005227 unedited
AAAAAAGTTTTCATATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGTG
AAGCGGGCCGGGACCTGCCAGGCCAGACCAAACCGGACCTCGGGGGCGATGCGGCTGCTG
CCCCTGCTGCGGACTGTCCTCTGGGCCGCGTTCCTCGGCTCCCCTCTGCGCGGGGGCTCC
AGCCTCCGCCACGTAGTCTACTGGAACTCCAGTAACCCCAGGTTGCTTCGAGGAGACGCC
GTGGTGGAGCTGGGCCTCAACGATTACCTAGACATTGTCTGCCCCCACTACGAAGGCCCA
GGGCCCCCTGAGGGCCCCGAGACGTTTGCTTTGTACATGGTGGACTGGCCAGGCTATGAG
TCCTGCCAGGCAGAGGGCCCCCGGGCCTACAAGCGCTGGGTGTGCTCCCTGCCCTTTGGC
CATGTTCAATTCTCAGAGAAGATTCAGCGCTTCACACCCTTCTCCCTCGGCTTTGAGTTC
TTACCTGGAGAGACTTACTACTACATCTCGGTGCCCACTCCAGAGAGTTCTGGCCAGTGC
TTGAGGCTCCAGGTGTCTGTCTGCTGCAAGGAGAGGAGAGCCAGAGTCCTCCCAAGATCC
CCTGGAGGAGGAGGGATCCCTGCTGCCTGCACTGGGGGTGCCAATTCAGACCGACAAGAT
GGAGCATTGATGGGGGAGATCAGAGGGTCTGAGGTGACTCTTGCANGAGCCTGTCCNCTC
ATCACAGGCTAAAGAAGAGCAGTANACAGCCCTGGACACTCTGAAGCAGGAGCAAGACAA
ACACAGGCGCCTTTGCAAGCTGCTCTGAGGGTCTCAGCCCATCCCCCAGGAGACTGGGAT
TTGGTATGATCAAATC
Restriction Sites NotI-NotI |
ACCN NM_005227
Insert Size 1350 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005227.2, NP_005218.1
RefSeq Size 1276 bp
RefSeq ORF 606 bp
Locus ID 1945
UniProt ID P52798
Cytogenetics 1q21.3
Domains Ephrin
Protein Families Secreted Protein
Protein Pathways Axon guidance
Summary This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNA class ephrin. Three transcript variants that encode distinct proteins have been identified. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1), also known as ephrin-A4 (m), is the longest transcript and it encodes isoform a. Isoform a is a membrane-bound protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_005227" in other vectors (6)
SKU Description Size Price
RC224388 EFNA4 (Myc-DDK-tagged)-Human ephrin-A4 (EFNA4), transcript variant 1 10 ug
$450.00
RC224388L1 Lenti ORF clone of Human ephrin-A4 (EFNA4), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC224388L2 Lenti ORF clone of Human ephrin-A4 (EFNA4), transcript variant 1, mGFP tagged 10 ug
$750.00
RC224388L3 Lenti ORF clone of Human ephrin-A4 (EFNA4), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC224388L4 Lenti ORF clone of Human ephrin-A4 (EFNA4), transcript variant 1, mGFP tagged 10 ug
$750.00
RG224388 EFNA4 (tGFP-tagged) - Human ephrin-A4 (EFNA4), transcript variant 1 10 ug
$650.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products