OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SIKE1 (NM_025073) Human Untagged Clone

Be the first to review this product
SKU
SC111370
SIKE1 (untagged)-Human suppressor of IKBKE 1 (SIKE1), transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA360687 SIKE1 Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SIKE1 or NM_025073"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SIKE1
Synonyms SIKE
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_025073, the custom clone sequence may differ by one or more nucleotides


ATGAGCTGCACCATCGAGAAGATCCTGACAGACGCCAAGACGCTGCTGGAGAGGCTACGGGAGCACGATG
CGGCCGCCGAGTCGCTGGTGGATCAGTCGGCGGCGCTGCACCGGCGGGTAGCAGCTATGCGGGAGGCGGG
GACAGCGCTTCCGGACCAGTATCAAGAGGATGCATCCGATATGAAGGACATGTCCAAATACAAACCTCAC
ATTCTGCTGTCCCAAGAGAACACACAGATTAGAGACTTGCAACAGGAAAACAGAGAGCTATGGATTTCCT
TGGAGGAACACCAGGATGCTTTGGAACTTATCATGAGCAAATATCGGAAACAGATGTTACAGTTAATGGT
TGCTAAAAAAGCGGTGGATGCTGAACCAGTCCTGAAAGCTCACCAGTCTCACTCTGCAGAAATTGAGAGT
CAGATTGACAGAATCTGTGAAATGGGAGAAGTGATGAGGAAAGCAGTTCAGGTGGATGATGACCAGTTTT
GTAAGATTCAGGAAAAATTAGCCCAATTAGAGCTTGAAAATAAGGAACTTCGAGAATTATTGTCCATCAG
CAGTGAGTCTCTTCAAGCCAGAAAGGAAAACTCAATGGACACTGCTTCCCAAGCCATCAAATAA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_025073 unedited
CAGGTTTTGTATACGACTCCTATAGGGCGGCCGCGATTCGGCACGAGGGGCAGGGGCTGG
GGTGGTGCTGCTGCTATGAGCTGCACCATCGAGAAGATCCTGACAGACGCCAAGACGCTG
CTGGAGAGGCTACGGGAGCACGATGCGGCCGCCGAGTCGCTGGTGGATCAGTCGGCGGCG
CTGCACCGGCGGGTAGCAGCTATGCGGGAGGCGGGGACAGCGCTTCCGGACCAGTATCAA
GAGGATGCATCCGATATGAAGGACATGTCCAAATACAAACCTCACATTCTGCTGTCCCAA
GAGAACACACAGATTAGAGACTTGCAACAGGAAAACAGAGAGCTATGGATTTCCTTGGAG
GAACACCAGGATGCTTTGGAACTTATCATGAGCAAATATCGGAAACAGATGTTACAGTTA
ATGGTTGCTAAAAAAGCGGTGGATGCTGAACCAGTCCTGAAAGCTCACCAGTCTCACTCT
GCAGAAATTGAGAGTCAGATTGACAGAATCTGTGAAATGGGAGAAGTGATGAGGAAAGCA
GTTCAGGTGGATGATGACCAGTTTTGTAAGATTCAGGAAAAATTAGCCCAATTAGAGCTT
GAAAATAAGGAACTTCGAGAATTATTGTCCATCAGCAGTGAGTCTCTTCAAGCCAGAAAG
GAAAACTCAATGGACACTGCTTCCCAAGCCATCAAATAACTGAACTCTNGATGATGGCTG
GNAGATGTCTATCAAGGAAGGAGTTACTGTCTTCCCATTCAGTACTGTCCATTAGTGTNC
TGGCTCAGATTGATTTATCTTAATAAAGTATCAGGTGGNCATTANAATCCAGTCATATTG
GCTGCCCACAGTCTCAGAGTGGTAATGGGATACTACATGCTGATTCACCATTCTTTTCAA
GAGACTACTT
Restriction Sites NotI-NotI |
ACCN NM_025073
Insert Size 5850 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_025073.1, NP_079349.1
RefSeq Size 2209 bp
RefSeq ORF 624 bp
Locus ID 80143
UniProt ID Q9BRV8
Cytogenetics 1p13.2
Protein Pathways RIG-I-like receptor signaling pathway
Summary SIKE interacts with IKK-epsilon (IKBKE; MIM 605048) and TBK1 (MIM 604834) and acts as a suppressor of TLR3 (MIM 603029) and virus-triggered interferon activation pathways (Huang et al., 2005 PubMed 16281057).supplied by OMIM, Mar 2008
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, which results in a protein (isoform 2) with a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_025073" in other vectors (6)
SKU Description Size Price
RC203262 SIKE1 (Myc-DDK-tagged)-Human suppressor of IKBKE 1 (SIKE1), transcript variant 2 10 ug
$300.00
RC203262L1 Lenti ORF clone of Human suppressor of IKBKE 1 (SIKE1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC203262L2 Lenti ORF clone of Human suppressor of IKBKE 1 (SIKE1), transcript variant 2, mGFP tagged 10 ug
$600.00
RC203262L3 Lenti ORF clone of Human suppressor of IKBKE 1 (SIKE1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC203262L4 Lenti ORF clone of Human suppressor of IKBKE 1 (SIKE1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG203262 SIKE1 (tGFP-tagged) - Human suppressor of IKBKE 1 (SIKE1), transcript variant 2 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products