OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

GLP2R (NM_004246) Human Untagged Clone

Be the first to review this product
SKU
SC111108
GLP2R (untagged)-Human glucagon-like peptide 2 receptor (GLP2R)
  $516.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA321635 Anti-GLP2R Rabbit Polyclonal Antibody
100 ul
$305.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "GLP2R or NM_004246"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GLP2R
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_004246, the custom clone sequence may differ by one or more nucleotides


ATGAAGCTGGGATCGAGCAGGGCAGGGCCTGGGAGAGGAAGCGCGGGACTCCTGCCTGGCGTCCACGAGC
TGCCCATGGGCATCCCTGCCCCCTGGGGGACCAGTCCTCTCTCCTTCCACAGGAAGTGCTCTCTCTGGGC
CCCTGGGAGGCCCTTCCTCACTCTGGTCCTGCTGGTTTCCATCAAGCAAGTTACAGGATCCCTCCTTGAG
GAAACGACTCGGAAGTGGGCTCAGTACAAACAGGCATGTCTGAGAGACTTACTCAAGGAACCTTCTGGCA
TATTTTGTAACGGGACATTTGATCAGTACGTGTGTTGGCCTCATTCTTCTCCTGGAAATGTCTCTGTACC
CTGCCCTTCATACTTACCTTGGTGGAGTGAAGAGAGCTCAGGAAGGGCCTACAGACACTGCTTGGCTCAG
GGGACTTGGCAGACGATAGAGAACGCCACGGATATTTGGCAGGATGACTCCGAATGCTCCGAGAACCACA
GCTTCAAGCAAAACGTGGACCGTTATGCCTTGCTGTCAACCTTGCAGCTGATGTACACCGTGGGATACTC
CTTCTCTCTTATCTCCCTCTTCCTGGCTCTCACCCTCCTCTTGTTTCTTCGAAAACTCCACTGCACGCGC
AACTACATCCACATGAACTTGTTTGCTTCTTTCATCCTGAGAACCCTGGCTGTACTGGTGAAGGACGTCG
TCTTCTACAACTCTTACTCCAAGAGGCCTGACAATGAGAATGGGTGGATGTCCTACCTGTCAGAGATGTC
CACCTCCTGCCGCTCAGTCCAGGTTCTCTTGCATTACTTTGTGGGTGCCAATTACTTATGGCTGCTGGTT
GAAGGCCTCTACCTCCACACGCTGCTGGAGCCCACAGTGCTTCCTGAGAGGCGGCTGTGGCCCAGATACC
TGCTGTTGGGTTGGGCCTTCCCTGTGCTATTTGTTGTACCCTGGGGTTTCGCCCGTGCACACCTGGAGAA
CACAGGGTGCTGGACAACAAATGGGAATAAGAAAATCTGGTGGATCATCCGAGGACCCATGATGCTCTGT
GTAACAGTCAATTTCTTCATCTTCCTGAAAATTCTCAAGCTTCTCATTTCTAAGCTCAAAGCTCATCAAA
TGTGCTTCAGAGATTATAAATACAGATTGGCAAAATCAACACTGGTCCTCATTCCTTTATTGGGCGTTCA
TGAGATCCTCTTCTCTTTCATCACTGATGATCAAGTTGAAGGATTTGCAAAACTTATACGACTTTTCATT
CAGTTGACACTGAGCTCCTTTCATGGGTTCCTGGTGGCCTTGCAGTATGGTTTTGCCAATGGAGAAGTGA
AGGCTGAGCTGCGGAAATACTGGGTCCGCTTCTTGCTAGCCCGCCACTCAGGCTGCAGAGCCTGTGTCCT
GGGGAAGGACTTCCGGTTCCTAGGAAAATGTCCCAAGAAGCTCTCGGAAGGAGATGGCGCTGAGAAGCTT
CGGAAGCTGCAGCCCTCACTTAACAGTGGGCGGCTCCTACATCTAGCCATGCGAGGTCTTGGGGAGCTGG
GCGCCCAGCCCCAACAGGACCATGCACGCTGGCCCCGGGGCAGCAGCCTGTCCGAGTGCAGTGAGGGGGA
TGTCACCATGGCCAACACCATGGAGGAGATTCTGGAAGAGAGTGAGATCTAG

5' Read Nucleotide Sequence
>OriGene 5' read for NM_004246 unedited
GATTTTGTATACGACTCACTATAGGGCGGCCCGCGATTCGGCACGAGCTCAGACACTCTC
GGCGCAGCGTGGAGAGGATTTGTGCAAACATTTCCTCTGTGGACCAAGAGGAATGCAAGA
GGAGGCTGCCTGCGGTGCATCTTGGACGGCTAGAGAGATGTACCCCTACTTGTGAAGGTG
CACGAGGAAGATGAAGCTGGGATCGAGCAGGGCAGGGCCTGGGAGAGGAAGCGCGGGACT
CCTGCCTGGCGTCCACGAGCTGCCCATGGGCATCCCTGCCCCCTGGGGGACCAGTCCTCT
CTCCTTCCACAGGAAGTGCTCTCTCTGGGCCCCTGGGAGGCCCTTCCTCACTCTGGTCCT
GCTGGTTTCCATCAAGCAAGTTACAGGATCCCTCCTTGAGGAAACGACTCGGAAGTGGGC
TCAGTACAAACAGGCATGTCTGAGAGACTTACTCAAGGAACCTTCTGGCATATTTTGTAA
CGGGACATTTGATCAGTACGTGTGTTGGCCTCATTCTTCTCCTGGAAATGTCTCTGTACC
CTGCCCTTCATACTTACCTTGGTGGAGTGAAGAGAGCTCAGGAAGGGCCTACAGACACTG
CTTGGCTCAGGGGACTTGGCAGACGATAGAGAACGCCACGGATATTTGGCAGGATGACTC
CGAGTGCTCCGAGAACCACAGCTTCAAGCAAAACGTGGATCGTTATGCCTTGCTGTCAAC
CTTGCAGCTGATGTACACCGTGGGATACTCCTTCTCTCTTATCTCCCTCTTCCTGGCTCT
CACCCTCCTCTTGNTTCTTCGAAAACTCCACTGCACGCGCAACTACATCCACATGAACTT
GNTTGCTTCTTTCATNCTGAGAACCCTGNCTGTACTGGTGAAGGACGTCGTCTTCTACAA
CTCTACTNCAGAGGCCTGACATGAGATGGNTGGATGTCCTACTGTCAGAGAGTCCACTCC
TGCGCTCAGTCAGNTCTCTT
Restriction Sites NotI-NotI |
ACCN NM_004246
Insert Size 4700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004246.1, NP_004237.1
RefSeq Size 1662 bp
RefSeq ORF 1662 bp
Locus ID 9340
UniProt ID O95838
Cytogenetics 17p13.1
Domains 7tm_2, HormR
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Summary This gene encodes a G protein-coupled receptor that is closely related to the glucagon receptor and binds to glucagon-like peptide-2 (GLP2). Signalling through GLP2 stimulates intestinal growth and increases villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis. provided by RefSeq, Dec 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_004246" in other vectors (6)
SKU Description Size Price
RC220745 GLP2R (Myc-DDK-tagged)-Human glucagon-like peptide 2 receptor (GLP2R) 10 ug
$289.00 $515.00
RC220745L1 Lenti ORF clone of Human glucagon-like peptide 2 receptor (GLP2R), Myc-DDK-tagged 10 ug
$815.00
RC220745L2 Lenti ORF clone of Human glucagon-like peptide 2 receptor (GLP2R), mGFP tagged 10 ug
$815.00
RC220745L3 Lenti ORF clone of Human glucagon-like peptide 2 receptor (GLP2R), Myc-DDK-tagged 10 ug
$815.00
RC220745L4 Lenti ORF clone of Human glucagon-like peptide 2 receptor (GLP2R), mGFP tagged 10 ug
$815.00
RG220745 GLP2R (tGFP-tagged) - Human glucagon-like peptide 2 receptor (GLP2R) 10 ug
$489.00 $715.00

file-alt Citations

AT-7687, a novel GIPR peptide antagonist, combined with a GLP-1 agonist, leads to enhanced weight loss and metabolic improvements in cynomolgus monkeys
Jensen, Sanni, Riber et al
Mol Metab (2024) 88, 102006 DOI: 10.1016/j.molmet.2024.102006
Cited by 38
AI Summary: OriGene contributed cDNAs for human GIPR (SC110906), GLP-1R (SC124060), GLP-2R (SC111108), and GCGR (SC120082), which were used to study receptor pharmacology in the development and characterization of the novel GIPR antagonist AT-7687.
Snippet: cDNAs of the human GIPR (hGIPR), GLP-1R, GLP-2R, and glucagon receptor (GCGR) were purchased from Origene (Rockville, Maryland, USA (catalog no. SC110906, SC124060, SC111108, and SC120082, respectively)). cDNA of the Macaca fascicularis GIPR was synthesized by GenScript
Biased GLP-2 agonist with strong G protein-coupling but impaired arrestin recruitment and receptor desensitization enhances intestinal growth in mice
Gabe, von Voss Christensen, Hunt et al
Br J Pharmacol (2023)
Cited by 17
AI Summary: OriGene contributed human GLP-2R (SC111108), human GLP-1R (SC124060), and mouse GLP-2R (MC217338) cDNA products, which were used to study receptor activation and signaling properties of biased GLP-2 agonists in this research.
Snippet: …cDNAsof human GLP-2R, human GLP-1R and mouse GLP-2R were purchased from Origene, Rockville, Maryland, USA (SC111108, SC124060 and MC217338, respectively)
N-terminal alterations turn the gut hormone GLP-2 into an antagonist with gradual loss of GLP-2 receptor selectivity towards more GLP-1 receptor interaction
Gabe, Gasbjerg, Gadgaard et al
Br J Pharmacol (2022) 179 (18), 4473-4485 DOI: 10.1111/bph.15866
Cited by 14
AI Summary: OriGene products contributed to this study by providing the cDNAs for human GLP-2R (SC111108), GLP-1R (SC124060), and GIPR (SC110906), which were used to transfect COS-7 cells for receptor binding and activity assays.
Snippet: …cDNAs of human GLP‐2R, human GLP‐1R and human GIPR were purchased from Origene, Rockville, Maryland, USA (SC111108, SC124060 and SC110906, respectively). … cDNAs of human GLP-2R, human GLP-1R and human GIPR were purchased from Origene, Rockville, Maryland, USA (SC111108, SC124060 and SC110906, respectively)
GIP(3-30)NH2 is an efficacious GIP receptor antagonist in humans: a randomised, double-blinded, placebo-controlled, crossover study
Gasbjerg, Christensen, Hartmann et al
Diabetologia (2017)
AI Summary: OriGene products (GHRH receptor cDNA clones: SC110906, SC124060, SC120082, SC111108, SC125725, and SC119635) were used in this study to express human GHRH receptors in vitro, enabling assessment of the specificity of GIP(3-30)NH2 for the GIP receptor compared to related receptors.
Snippet: … GHRH were purchased from Origene (Rockville, MD, USA;SC110906, SC124060, SC120082, SC111108, SC125725 and SC119635, respectively) and cloned into pCMV Script- vectors (Agilent Technologies Denmark, Glostrup, Denmark). ...;... … GHRH were purchased from Origene (Rockville, MD, USA;SC110906, SC124060, SC120082, SC111108, SC125725 and SC119635, respectively) and cloned into pCMV Script- vectors (Agilent Technologies Denmark, Glostrup, Denmark).
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products