OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

FGF10 (NM_004465) Human Untagged Clone

Be the first to review this product
SKU
SC110895
FGF10 (untagged)-Human fibroblast growth factor 10 (FGF10)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "FGF10 or NM_004465"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FGF10
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_004465, the custom clone sequence may differ by one or more nucleotides


ATGTGGAAATGGATACTGACACATTGTGCCTCAGCCTTTCCCCACCTGCCCGGCTGCTGCTGCTGCTGCT
TTTTGTTGCTGTTCTTGGTGTCTTCCGTCCCTGTCACCTGCCAAGCCCTTGGTCAGGACATGGTGTCACC
AGAGGCCACCAACTCTTCTTCCTCCTCCTTCTCCTCTCCTTCCAGCGCGGGAAGGCATGTGCGGAGCTAC
AATCACCTTCAAGGAGATGTCCGCTGGAGAAAGCTATTCTCTTTCACCAAGTACTTTCTCAAGATTGAGA
AGAACGGGAAGGTCAGCGGGACCAAGAAGGAGAACTGCCCGTACAGCATCCTGGAGATAACATCAGTAGA
AATCGGAGTTGTTGCCGTCAAAGCCATTAACAGCAACTATTACTTAGCCATGAACAAGAAGGGGAAACTC
TATGGCTCAAAAGAATTTAACAATGACTGTAAGCTGAAGGAGAGGATAGAGGAAAATGGATACAATACCT
ATGCATCATTTAACTGGCAGCATAATGGGAGGCAAATGTATGTGGCATTGAATGGAAAAGGAGCTCCAAG
GAGAGGACAGAAAACACGAAGGAAAAACACCTCTGCTCACTTTCTTCCAATGGTGGTACACTCATAG

5' Read Nucleotide Sequence
>OriGene 5' read for NM_004465 unedited
GTGCCCATTTGTATACGACTCATATAGGGCGGCCGCGATTCGGCACGAGGGCAGCCACCA
CCTCGAGCTCTCTCCTTGCCTTGCATCGGGTCTTACCCTTCCAGTATGTTCCTTCTGATG
AGACAATTTCCAGTGCCGAGAGTTTCAGTACAATGTGGAAATGGATACTGACACATTGTG
CCTCAGCCTTTCCCCACCTGCCCGGCTGCTGCTGCTGCTGCTTTTTGTTGCTGTTCTTGG
TGTCTTCCGTCCCTGTCACCTGCCAAGCCCTTGGTCAGGACATGGTGTCACCAGAGGCCA
CCAACTCTTCTTCCTCCTCCTTCTCCTCTCCTTCCAGCGCGGGAAGGCATGTGCGGAGCT
ACAATCACCTTCAAGGAGATGTCCGCTGGAGAAAGCTATTCTCTTTCACCAAGTACTTTC
TCAAGATTGAGAAGAACGGGAAGGTCAGCGGGACCAAGAAGGAGAACTGCCCGTACAGCA
TCCTGGAGATAACATCAGTAGAAATCGGAGTTGTTGCCGTCAAAGCCATTAACAGCAACT
ATTACTTAGCCATGAACAAGAAGGGGAAACTCTATGGCTCAAAAGAATNTAACAATGACT
GTAAGCTGAAGGAGAGGATAGAGGAAAATGGATACAATACCTATGCATCATTTAACTGGC
AGCATAATGGGAGGCAAATGTATGTGGCATTGAATGGAAAAGGAGCCTTCAGGAGAGGGA
CAGAAACACGAAGGANAAACACCTCTGCTCACTTTCTCCCATGGTGGTACACTCATAGAG
GAAGCAACGTTTGTTGATGCAGAAAACCAATGGCTCTTTTGCCAAAATAGTGGATATTCT
CATGAAGACAGTTGATGAAAGGCAAAGACCCTTGCAAATGTCTGCTTGCTTTAAAGAAGC
CACCTTTGAAGTTTTTGATTTACT
Restriction Sites NotI-NotI |
ACCN NM_004465
Insert Size 3710 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004465.1, NP_004456.1
RefSeq Size 627 bp
RefSeq ORF 627 bp
Locus ID 2255
UniProt ID O15520
Cytogenetics 5p12
Domains FGF
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Secreted Protein, Transcription Factors, Transmembrane
Protein Pathways MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
Summary The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. Studies of the mouse homolog of suggested that this gene is required for embryonic epidermal morphogenesis including brain development, lung morphogenesis, and initiation of lim bud formation. This gene is also implicated to be a primary factor in the process of wound healing. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_004465" in other vectors (6)
SKU Description Size Price
RC210120 FGF10 (Myc-DDK-tagged)-Human fibroblast growth factor 10 (FGF10) 10 ug
$300.00
RC210120L1 Lenti ORF clone of Human fibroblast growth factor 10 (FGF10), Myc-DDK-tagged 10 ug
$600.00
RC210120L2 Lenti ORF clone of Human fibroblast growth factor 10 (FGF10), mGFP tagged 10 ug
$600.00
RC210120L3 Lenti ORF clone of Human fibroblast growth factor 10 (FGF10), Myc-DDK-tagged 10 ug
$600.00
RC210120L4 Lenti ORF clone of Human fibroblast growth factor 10 (FGF10), mGFP tagged 10 ug
$600.00
RG210120 FGF10 (tGFP-tagged) - Human fibroblast growth factor 10 (FGF10) 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products