OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PTP4A3 (NM_007079) Human Untagged Clone

Be the first to review this product
SKU
SC110233
PTP4A3 (untagged)-Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 2
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA380525 PTP4A3 Rabbit polyclonal Antibody
100 ul
$410.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PTP4A3 or NM_007079"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PTP4A3
Synonyms PRL-3; PRL-R; PRL3
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC110233 sequence for NM_007079 edited (data generated by NextGen Sequencing)
ATGGCTCGGATGAACCGCCCGGCCCCGGTGGAGGTGAGCTACAAACACATGCGCTTCCTC
ATCACCCACAACCCCACCAACGCCACGCTCAGCACCTTCATTGAGGACCTGAAGAAGTAC
GGGGCTACCACTGTGGTGCGTGTGTGTGAAGTGACCTATGACAAAACGCCGCTGGAGAAG
GATGGCATCACCGTTGTGGACTGGCCGTTTGACGATGGGGCGCCCCCGCCCGGCAAGGTA
GTGGAAGACTGGCTGAGCCTGGTGAAGGCCAAGTTCTGTGAGGCCCCCGGCAGCTGCGTG
GCTGTGCACTGCGTGGCGGGCCTGGGCCGGAAGCGCCGCGGAGCCATCAACAGCAAGCAG
CTCACCTACCTGGAGAAATACCGGCCCAAACAGAGGCTGCGGTTCAAAGACCCACACACG
CACAAGACCCGGTGCTGCGTTATGTAG

Clone variation with respect to NM_007079.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_007079 unedited
NGGTAAAGTTCAAATTTAGTATACGACTCATATAGGCGGCNCGCGATTCGGCACGAGGTG
ACTATCCAGCTCTGAGAGACGGGAGTTTGGAGTTGCCCGCTTTACTTTGGTTGGGTTGGG
GGGGGCGGCGGGCTGTTTTGTTCCTTTTCTTTTTTAAGAGTTGGGTTTTCTTTTTTAATT
ATCCAAACAGTGGGCAGCTTCCTCCCCCACACCCAAGTATTTGCACAATATTTGTGCGGG
GTATGGGGGTGGGTTTTTAAATCTCGTTTCTCTTGGACAAGCACAGGGATCTCGTTCTCC
TCATTTTTTGGGGGTGTGTGGGGACTTCTCAGGTCGTGTCCCCAGCCTTCTCTGCAGTCC
CTTCTGCCCTGCCGGGCCCGTCGGGAGGCGCCATGGCTCGGATGAACCGCCCGGCCCCGG
TGGAGGTGAGCTACAAACACATGCGCTTCCTCATCACCCACAACCCCACCAACGCCACGC
TCAGCACCTTCATTGAGGACCTGAAGAAGTACGGGGCTACCACTGTGGTGCGTGTGTGTG
AAGTGACCTATGACAAAACGCCGCTGGAGAAGGATGGCATCACCGTTGTGGACTGGCCGT
TTGACGATGGGGCGCCCCCGCCCGGCAAGGTAGTGGAAGACTGGCTGAGCCTGGTGAAGG
CCAAGTTCTGTGAGGCCCCCGGCAGCTGCGTGGCTGTGCACTGCGTGGCGGGCCTGGGCC
GGAAGCGCCGCGGGAGCCTCAACAGCAAGCAGCTCACCTACCTGGAAAAATACCGGCCCA
ACAGGAGCTGCGGGTTCAAAGCCCCCACACGCCCAAGACCCCGGGCTGCGTTATGTAGCT
CAGGAACCTGGCTGGGCCTC
Restriction Sites Please inquire |
ACCN NM_007079
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007079.2, NP_009010.2
RefSeq Size 1321 bp
RefSeq ORF 447 bp
Locus ID 11156
UniProt ID O75365
Cytogenetics 8q24.3
Protein Families Druggable Genome, Phosphatase
Summary This gene encodes a member of the protein-tyrosine phosphatase family. Protein tyrosine phosphatases are cell signaling molecules that play regulatory roles in a variety of cellular processes. Studies of this class of protein tyrosine phosphatase in mice demonstrates that they are prenylated in vivo, suggesting their association with cell plasma membrane. The encoded protein may enhance cell proliferation, and overexpression of this gene has been implicated in tumor metastasis. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jul 2013
Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_007079" in other vectors (4)
SKU Description Size Price
RC217944 PTP4A3 (Myc-DDK-tagged)-Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 2 10 ug
$150.00
RC217944L3 Lenti ORF clone of Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC217944L4 Lenti ORF clone of Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 2, mGFP tagged 10 ug
$450.00
RG217944 PTP4A3 (tGFP-tagged) - Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 2 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products