OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PSMA1 (NM_002786) Human Untagged Clone

Be the first to review this product
SKU
SC109640
PSMA1 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA812757 PSMA1 mouse monoclonal antibody,clone OTI9H1 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PSMA1 or NM_002786"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PSMA1
Synonyms HC2; HEL-S-275; NU; PROS30
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC109640 sequence for NM_002786 edited (data generated by NextGen Sequencing)
ATGTTTCGAAATCAGTATGACAATGATGTCACTGTTTGGAGCCCCCAGGGCAGGATTCAT
CAAATTGAATATGCAATGGAAGCTGTTAAACAAGGTTCAGCCACAGTTGGTCTGAAATCA
AAAACTCATGCAGTTTTGGTTGCATTGAAAAGGGCGCAATCAGAGCTTGCAGCTCATCAG
AAAAAAATTCTCCATGTTGACAACCATATTGGTATCTCAATTGCGGGGCTTACTGCTGAT
GCTAGACTGTTATGTAATTTTATGCGTCAGGAGTGTTTGGATTCCAGATTTGTATTCGAT
AGACCACTGCCTGTGTCTCGTCTTGTATCTCTAATTGGAAGCAAGACCCAGATACCAACA
CAACGATATGGCCGGAGACCATATGGTGTTGGTCTCCTTATTGCTGGTTATGATGATATG
GGCCCTCACATTTTCCAAACCTGTCCATCTGCTAACTATTTTGACTGCAGAGCCATGTCC
ATTGGAGCCCGTTCCCAATCAGCTCGTACTTACTTGGAGAGACATATGTCTGAATTTATG
GAGTGTAATTTAAATGAACTAGTTAAACATGGTCTGCGTGCCTTAAGAGAGACGCTTCCT
GCAGAACAGGACCTGACTACAAAGAATGTTTCCATTGGAATTGTTGGTAAAGACTTGGAG
TTTACAATCTATGATGATGATGATGTGTCTCCATTCCTGGAAGGTCTTGAAGAAAGACCA
CAGAGAAAGGCACAGCCTGCTCAACCTGCTGATGAACCTGCAGAAAAGGCTGATGAACCA
ATGGAACATTAA

Clone variation with respect to NM_002786.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002786 unedited
NGGGGTTGCACATTTGTATACGACTCATATAGGCGGCCGCGAAATTCGCACGAGGCTCTG
TAGATCGCTGAGCGATACTTTCGGCAGCACCTCCTTGATTCTCAGTTTTGCTGGAGGCCG
CAACCAGGCCCGCGCCGCCACCATGTTTCGAAATCAGTATGACAATGATGTCACTGTTTG
GAGCCCCCAGGGCAGGATTCATCAAATTGAATATGCAATGGAAGCTGTTAAACAAGGTTC
AGCCACAGTTGGTCTGAAATCAAAAACTCATGCAGTTTTGGTTGCATTGAAAAGGGCGCA
ATCAGAGCTTGCAGCTCATCAGAAAAAAATTCTCCATGTTGACAACCATATTGGTATCTC
AATTGCGGGGCTTACTGCTGATGCTAGACTGTTATGTAATTTTATGCGTCAGGAGTGTTT
GGATTCCAGATTTGTATTCGATAGACCACTGCCTGTGTCTCGTCTTGTATCTCTAATTGG
AAGCAAGACCCAGATACCAACACAACGATATGGCCGGAGACCATATGGTGTTGGTCTCCT
TATTGCTGGTTATGATGATATGGGCCCTCACATTTTCCAAACCTGTCCATCTGCTAACTA
TTTTGACTGCAGAGCCATGTCCATTGGAGCCCGTTCCCAATCAGCTCGTACTTACTTGGA
GAGACATATGTCTGAATTTATGGAGTGTAATTTAAATGAACTAGTTAAACATGGNTCTGC
GTGCCTTAAGAGAGACGCTTCCTGCAGAACAGGACCTGACTACAAAAATGTTTCCATTGG
AATTGTTGGTAAAGACTTGGAGTTTACAATCTATGATGATGATGATGTGTCTCCATTCCC
TGGAAAGTCTTGNAGAAAGACCACAGAGAAAGGCACAGCCTGCTCAACCTGCTGATGAAC
CTGCAGAAAGGA
Restriction Sites NotI-NotI |
ACCN NM_002786
Insert Size 1250 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002786.2, NP_002777.1
RefSeq Size 1238 bp
RefSeq ORF 792 bp
Locus ID 5682
UniProt ID P25786
Cytogenetics 11p15.2
Domains proteasome
Protein Families Druggable Genome, Protease
Protein Pathways Proteasome
Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Alternative splicing results in multiple transcript variants encoding distinct isoforms.provided by RefSeq, Jan 2009
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (2), also known as the short isoform, has a shorter N-terminus compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002786" in other vectors (7)
SKU Description Size Price
RC203260 PSMA1 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 2 10 ug
$300.00
RC203260L1 Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC203260L2 Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 2, mGFP tagged 10 ug
$600.00
RC203260L3 Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC203260L4 Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG203260 PSMA1 (tGFP-tagged) - Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 2 10 ug
$489.00 $500.00
SC320849 PSMA1 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1), transcript variant 2 10 ug
$300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products