OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CDC42SE2 (NM_020240) Human Untagged Clone

Be the first to review this product
SKU
SC108682
CDC42SE2 (untagged)-Human CDC42 small effector 2 (CDC42SE2), transcript variant 1
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA808192 CDC42SE2 mouse monoclonal antibody, clone OTI1B12 (formerly 1B12) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CDC42SE2 or NM_020240"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CDC42SE2
Synonyms SPEC2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC108682 sequence for NM_020240 edited (data generated by NextGen Sequencing)
ATGAGTGAATTCTGGTTGTGTTTCAACTGCTGTATTGCAGAACAGCCTCAGCCTAAAAGG
CGACGGCGGATTGACAGAAGTATGATTGGAGAGCCCACAAACTTTGTGCATACAGCTCAT
GTTGGATCAGGAGACCTGTTCAGTGGAATGAATTCAGTTAGCTCCATTCAGAACCAAATG
CAGTCCAAGGGAGGTTATGGAGGTGGAATGCCTGCCAATGTCCAGATGCAGCTCGTGGAT
ACGAAGGCGGGATAG

Clone variation with respect to NM_020240.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_020240 unedited
TCCACAATTTGTAAACGACTCATATAGGCGGCCGCGNAATTCGCACGAGGTAGAACCGAA
CAAGAAGGAAACAATCCAAATTTTTCTTTATAATCGCTGTGTAAGATACTTGACTTCCAG
GAACAAAAACACGGTGAAATAATAAAATTTCATCTTGGCATCACTGGACATCATCGTATT
GAGGAGCGTATTTTTGGAACTTCCCGAGTTGAGATTTGGAACCTTCATTGGTGCTCATTT
ACTGTGGACTGTAAGCATGAGTGAATTCTGGTTGTGTTTCAACTGCTGTATTGCAGAACA
GCCTCAGCCTAAAAGGCGACGGCGGATTGACAGAAGTATGATTGGAGAGCCCACAAACTT
TGTGCATACAGCTCATGTTGGATCAGGAGACCTGTTCAGTGGAATGAATTCAGTTAGCTC
CATTCAGAACCAAATGCAGTCCAAGGGAGGTTATGGAGGTGGAATGCCTGCCAATGTCCA
GATGCAGCTCGTGGATACGAAGGCGGGATAGCCCTGGTCCTTTCTCCAGGTTATTGTGAA
TTTCTATATTTTCTCTGTCCACTATTCTGTAATTTTTTTTTGTCCTGTGATTTGCTTTAT
NTTGGATTACAAAAAGAAGTGTGATGGCACCTTGTCCACCCTGTCGTGATTATTCCAGTG
AGATNGTACTGTTCTGCTCTGAAGAGATACTGTCAGACGAATTCTGCATTTCCCTCAGCT
GGCATGCATGCCTTTGGACTCATGGACAGAGTTCTTTGGATTGTCACTGAATTTCCATGG
TTAATCAGTATGGATCTGATCCTCCCATGATCTTTTTGGGGATGCTAACCCATTTTGCAA
GTTTTTTTTCCTATTAAAACATTTTTTTTTACTGCCGACCCCTGCCTAACCTTTTATTGG
AAGCAAGGCCTGGATTAATTGTAAT
Restriction Sites NotI-NotI |
ACCN NM_020240
Insert Size 1410 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020240.1, NP_064625.1
RefSeq Size 255 bp
RefSeq ORF 255 bp
Locus ID 56990
UniProt ID Q9NRR3
Cytogenetics 5q31.1
Protein Families Druggable Genome
Summary Probably involved in the organization of the actin cytoskeleton by acting downstream of CDC42, inducing actin filament assembly. Alters CDC42-induced cell shape changes. In activated T-cells, may play a role in CDC42-mediated F-actin accumulation at the immunological synapse. May play a role in early contractile events in phagocytosis in macrophages.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_020240" in other vectors (6)
SKU Description Size Price
RC212101 CDC42SE2 (Myc-DDK-tagged)-Human CDC42 small effector 2 (CDC42SE2), transcript variant 1 10 ug
$150.00
RC212101L1 Lenti ORF clone of Human CDC42 small effector 2 (CDC42SE2), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC212101L2 Lenti ORF clone of Human CDC42 small effector 2 (CDC42SE2), transcript variant 1, mGFP tagged 10 ug
$450.00
RC212101L3 Lenti ORF clone of Human CDC42 small effector 2 (CDC42SE2), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC212101L4 Lenti ORF clone of Human CDC42 small effector 2 (CDC42SE2), transcript variant 1, mGFP tagged 10 ug
$450.00
RG212101 CDC42SE2 (tGFP-tagged) - Human CDC42 small effector 2 (CDC42SE2), transcript variant 1 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products