OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Dectin 1 (CLEC7A) (NM_197954) Human Untagged Clone

Be the first to review this product
SKU
SC107747
CLEC7A (untagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 6
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA320003 Rabbit Polyclonal CLEC7A Antibody
100 ug
$640.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Dectin 1 or NM_197954"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Dectin 1
Synonyms BGR; CANDF4; CD369; CLECSF12; DECTIN1; SCARE2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC107747 sequence for NM_197954 edited (data generated by NextGen Sequencing)
ATGGAATATCATCCTGATTTAGAAAATTTGGATGAAGATGGATATACTCAATTACACTTC
GACTCTCAAAGCAATACCAGGATAGCTGTTGTTTCAGAGAAAGGATCGTGTGCTGCATCT
CCTCCTTGGCGCCTCATTGCTGTAATTTTGGGAATCCTATGCTTGGTAATACTGGTGATA
GCTGTGGTCCTGGGTACCATGGCTGGTTTCAAAGCTGTGGAATTCAAAGGATAA

Clone variation with respect to NM_197954.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_197954 unedited
NNNNNNCCTTCTTACCCCCGCCCGTTGCCTCAAAGGGCGGTAGGCGTGTACGGTGGGNAG
GTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATA
GGGCGGCCGCGAATTCGGCACGAGCAGGAGCAGAAAGAAAAGAGCTCCCAAATGCTATAT
CTATTCAGGGGCTCTCAAGAACAATGGAATATCATCCTGATTTAGAAAATTTGGATGAAG
ATGGATATACTCAATTACACTTCGACTCTCAAAGCAATACCAGGATAGCTGTTGTTTCAG
AGAAAGGATCGTGTGCTGCATCTCCTCCTTGGCGCCTCATTGCTGTAATTTTGGGAATCC
TATGCTTGGTAATACTGGTGATAGCTGTGGTCCTGGGTACCATGGCTGGTTTCAAAGCTG
TGGAATTCAAAGGATAAATTAATGAAGAAAACAAGCGGAGCTGAAGAAGAAAGTACAATA
TGGTGCTGTCTTCCTAATGAAATAAATTCACTAAATGGACCAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAACTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATC
CCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTC
CAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGT
CCTTCTTAATATATGGGGTGGAGGGGGGGGGNNTTNNNAACCAAGGGGCAAGTGGGGGAA
GACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATC
TTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAGCAATTCTCCGCCTCAA
Restriction Sites NotI-NotI |
ACCN NM_197954
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_197954.1, NP_922945.1
RefSeq Size 511 bp
RefSeq ORF 234 bp
Locus ID 64581
UniProt ID Q9BXN2
Cytogenetics 12p13.2
Protein Families Druggable Genome, Transmembrane
Summary This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. The encoded glycoprotein is a small type II membrane receptor with an extracellular C-type lectin-like domain fold and a cytoplasmic domain with an immunoreceptor tyrosine-based activation motif. It functions as a pattern-recognition receptor that recognizes a variety of beta-1,3-linked and beta-1,6-linked glucans from fungi and plants, and in this way plays a role in innate immune response. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. provided by RefSeq, Jul 2008
Transcript Variant: This variant (6) has multiple differences in the coding region, compared to variant 1, one of which results in an early stop codon. The resulting protein (isoform f) has a distinct C-terminus and is much shorter than isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_197954" in other vectors (4)
SKU Description Size Price
RC222007 CLEC7A (Myc-DDK-tagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 6 10 ug
$150.00
RC222007L3 Lenti ORF clone of Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 6, Myc-DDK-tagged 10 ug
$450.00
RC222007L4 Lenti ORF clone of Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 6, mGFP tagged 10 ug
$450.00
RG222007 CLEC7A (tGFP-tagged) - Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 6 10 ug
$350.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products