OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

RNASE4 (NM_194431) Human Untagged Clone

Be the first to review this product
SKU
SC107718
RNASE4 (untagged)-Human ribonuclease, RNase A family, 4 (RNASE4), transcript variant 3
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA366113 RNASE4 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "RNASE4 or NM_194431"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RNASE4
Synonyms RAB1; RNS4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_194431 edited
ATGGCTCTGCAGAGGACCCATTCATTGCTTCTGCTTTTGCTGCTGTCCCTGCTGGGGCTG
GGGCTGGTCCAGCCCTCCTATGGCCAGGATGGCATGTACCAGCGATTCCTGCGGCAACAC
GTGCACCCTGAGGAGACAGGTGGCAGTGATCGCTACTGCAACTTGATGATGCAAAGACGG
AAGATGACTTTGTATCACTGCAAGCGCTTCAACACCTTCATCCATGAAGATATCTGGAAC
ATTCGTAGTATCTGCAGCACCACCAATATCCAATGCAAGAACGGCAAGATGAACTGCCAT
GAGGGTGTAGTGAAGGTCACAGATTGCAGGGACACAGGAAGTTCCAGGGCACCCAACTGC
AGATATCGGGCCATAGCGAGCACTAGACGTGTTGTCATTGCCTGTGAGGGTAACCCACAG
GTGCCTGTGCACTTTGACGGTTAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_194431 unedited
NGGGCTGTCAGATTTGTATACGACTCACTATAGGCGGCCGCGATTCGGCACCAGGGTTCA
CACAACTGNGAACCCATCTCCAGGAACAAACAGCTGGAACCCATCTCCCGTTGAAGGGAA
ACTGCCAGATTTTTGTAAGATTCTTCCTCCTGGGCACCTCTAAGATACTGATGGCTCTGC
AGAGGACCCATTCATTGCTTCTGCTTTTGCTGCTGTCCCTGCTGGGGCTGGGGCTGGTCC
AGCCCTCCTATGGCCAGGATGGCATGTACCAGCGATTCCTGCGGCAACACGTGCACCCTG
AGGAGACAGGTGGCAGTGATCGCTACTGCAACTTGATGATGCAAAGACGGAAGATGACTT
TGTATCACTGCAAGCGCTTCAACACCTTCATCCATGAAGATATCTGGAACATTCGTAGTA
TCTGCAGCACCACCAATATCCAATGCAAGAACGGCAAGATGAACTGCCATGAGGGTGTAG
TGAAGGTCACAGATTGCAGGGACACAGGAAGTTCCAGGGCACCCAACTGCAGATATCGGG
CCATAGCGAGCACTAGACGTGTTGTCATTGCCTGTGAGGGTAACCCACAGGTGCCTGTGC
ACTNTGACGGTTAGATGCCACCATGTANGGATTATCGCGAGTGGTTGACCTTACACTTAC
TCCTTNAATAGCAGTGAGTAATGCATTTGAGCTGTTCCCAGCTCTGTCTCCTCAGCTCAT
TTCCTACTCTNTTTCTCTATATAACTCATTCTATTAAATACATTGCACCAAAGAGATAGG
NAGACCATAACCCTGTATGAATGAGGGGCTGGCTTTCTGTATAAGCTTCCTTTATATACT
GGNCAGCTTACTCTCTCAGATCTATNCTGGGG
Restriction Sites NotI-NotI |
ACCN NM_194431
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_194431.1, NP_919412.1
RefSeq Size 1361 bp
RefSeq ORF 444 bp
Locus ID 6038
UniProt ID P34096
Cytogenetics 14q11.2
Protein Families Secreted Protein, Transmembrane
Summary The protein encoded by this gene belongs to the pancreatic ribonuclease family. It plays an important role in mRNA cleavage and has marked specificity towards the 3' side of uridine nucleotides. Alternative splicing results in four transcript variants encoding the same protein. This gene and the gene that encodes angiogenin share promoters and 5' exons. Each gene splices to a unique downstream exon that contains its complete coding region. provided by RefSeq, Aug 2013
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 4. All four variants encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_194431" in other vectors (6)
SKU Description Size Price
RC214405 RNASE4 (Myc-DDK-tagged)-Human ribonuclease, RNase A family, 4 (RNASE4), transcript variant 3 10 ug
$150.00
RC214405L1 Lenti ORF clone of Human ribonuclease, RNase A family, 4 (RNASE4), transcript variant 3, Myc-DDK-tagged 10 ug
$450.00
RC214405L2 Lenti ORF clone of Human ribonuclease, RNase A family, 4 (RNASE4), transcript variant 3, mGFP tagged 10 ug
$450.00
RC214405L3 Lenti ORF clone of Human ribonuclease, RNase A family, 4 (RNASE4), transcript variant 3, Myc-DDK-tagged 10 ug
$450.00
RC214405L4 Lenti ORF clone of Human ribonuclease, RNase A family, 4 (RNASE4), transcript variant 3, mGFP tagged 10 ug
$450.00
RG214405 RNASE4 (tGFP-tagged) - Human ribonuclease, RNase A family, 4 (RNASE4), transcript variant 3 10 ug
$489.00

file-alt Citations

Insights into the role of Ribonuclease 4 polymorphisms in Amyotrophic Lateral Sclerosis
Padhi, Narain, Dave et al
J. Biomol. Struct. Dyn. (2017)
AI Summary: OriGene’s pCMV6-XL4 plasmid containing human RNASE4 cDNA was used as the template for PCR amplification, enabling the cloning and expression of RNASE4 variants for functional assays in the study.
Snippet: The cDNA for human RNASE4 gene (360bp) was PCR amplified from the plasmid pCMV6- XL4 (OriGene) and subsequently cloned in BamHI and EcoRI restriction sites of the E.coli expression vector pGEX-6P-2 (GE-Healthcare), having a C-terminal hexa-histidine
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products