OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

RBM18 (NM_033117) Human Untagged Clone

Be the first to review this product
SKU
SC101714
RBM18 (untagged)-Human RNA binding motif protein 18 (RBM18), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA343961 Rabbit Polyclonal Anti-RBM18 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "RBM18 or NM_033117"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RBM18
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC101714 sequence for NM_033117 edited (data generated by NextGen Sequencing)
ATGGAAGCAGAAACCAAAACTCTTCCCCTGGAGAATGCATCCATCCTTTCAGAGGGCTCT
CTGCAGGAAGGACACCGATTATGGATTGGCAACCTGGACCCCAAAATTACCGAATACCAC
CTCCTCAAGCTCCTCCAGAAGTTTGGCAAGGTAAAGCAGTTTGACTTCCTCTTCCACAAG
TCAGGTGCTTTGGAGGGACAGCCTCGAGGCTACTGTTTTGTTAACTTTGAAACTAAGCAG
GAAGCAGAGCAAGCCATCCAGTGTCTCAATGGCAAGTTGGCCCTGTCCAAGAAGCTGGTG
GTGCGATGGGCACATGCTCAAGTAAAGAGATATGATCATAACAAGAATGATAAGATTCTT
CCAATCAGTCTCGAGCCATCCTCAAGCACTGAGCCTACTCAGTCTAACCTAAGTGTCACT
GCAAAGATAAAAGCCATTGAAGCAAAACTGAAAATGATGGCGGAAAATCCTGATGCAGAG
TATCCAGCAGCGCCTGTTTATTCCTACTTTAAGCCACCAGATAAAAAAAGGACTACTCCA
TATTCTAGAACAGCATGGAAATCTCGAAGATGA

Clone variation with respect to NM_033117.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_033117 unedited
GTCGAGAATTTGTAATACGATTCACTATAGGGCGGCCGCGCCTCGTGCCGAATTCGGCAC
GAGGGGCATTGAGGCGGACGCGTGTAGAGGTCCGTCTGACCGCGGCGTCGGGACCTGGTT
TCCGGGCATGAGCTGAGAGCACCACGCCGAGGCCACGAGTATTTCATAGACATTGATGGA
AGCAGAAACCAAAACTCTTCCCCTGGAGAATGCATCCATCCTTTCAGAGGGCTCTCTGCA
GGAAGGACACCGATTATGGATTGGCAACCTGGACCCCAAAATTACCGAATACCACCTCCT
CAAGCTCCTCCAGAAGTTTGGCAAGGTAAAGCAGTTTGACTTCCTCTTCCACAAGTCAGG
TGCTTTGGAGGGACAGCCTCGAGGCTACTGTTTTGTTAACTTTGAAACTAAGCAGGAAGC
AGAGCAAGCCATCCAGTGTCTCAATGGCAAGTTGGCCCTGTCCAAGAAGCTGGTGGTGCG
ATGGGCACATGCTCAAGTAAAGAGATATGATCATAACAAGAATGATAAGATTCTTCCAAT
CAGTCTCGAGCCATCCTCAAGCACTGAGCCTACTCAGTCTAACCTAAGTGTCACTGCAAA
GATAAAAGCCATTGAAGCAAAACTGAAAATGATGGCGGAAAATCCTGATGCAGAGTATCC
AGCAGCGCCTGTTTATTCCTACTTTTAGCCACCAGATAAAAAAGGACTACTCCATATCCT
AGAACAGCATGGAAATCTCGAAGAAGATGGCTGTGAATTACTGTAGCAGCCAAAGCAAAT
TGGTCTTCCCACCCTAAAATCGTCTGCCTGGGTACTCTGTAAAGGGAATGGTACTATTCA
ACGGAGCACATTACATGGTAACATTTGGAACATAATGTTTTTGAAGGTCTAAAGAACGGC
CCTCCCTAACATGGATGGAATTGACCCCATCCG
Restriction Sites NotI-NotI |
ACCN NM_033117
Insert Size 2710 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_033117.2, NP_149108.1
RefSeq Size 1087 bp
RefSeq ORF 573 bp
Locus ID 92400
UniProt ID Q96H35
Cytogenetics 9q33.2
Domains RRM
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_033117" in other vectors (4)
SKU Description Size Price
RC200878 RBM18 (Myc-DDK-tagged)-Human RNA binding motif protein 18 (RBM18), transcript variant 1 10 ug
$300.00
RC200878L3 Lenti ORF clone of Human RNA binding motif protein 18 (RBM18), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200878L4 Lenti ORF clone of Human RNA binding motif protein 18 (RBM18), transcript variant 1, mGFP tagged 10 ug
$600.00
RG200878 RBM18 (tGFP-tagged) - Human RNA binding motif protein 18 (RBM18), transcript variant 1 10 ug
$500.00

file-alt Citations

FBXO32 activates NF-κB through IκBα degradation in inflammatory and genotoxic stress
Meshram, Paul, Manne et al
Int. J. Biochem. Cell Biol. (2017) 92, 134-140 DOI: 10.1016/j.biocel.2017.09.021
AI Summary: In this study, OriGene Technologies contributed the DDK antibody (cat# TA50011-5), which was used to detect tagged proteins and support the investigation of FBXO32's role in NF-κB pathway activation.
Snippet: IκBα (cat# SC-371, SC-1643), phospho-IκBαSer32/36) (cat# SC-101713), HA probe (cat#SC-7392) were obtained from Santa Cruz (California, USA), FBXO32 (cat#PA5-19056) and DDK (cat# TA50011-5) from Thermo Scientific (Rockford, IL USA) and OriGene Technologies ...;... IκBα (cat# SC-371, SC-1643), phospho-IκBαSer32/36) (cat# SC-101713), HA probe (cat#SC-7392) were obtained from Santa Cruz (California, USA), FBXO32 (cat#PA5-19056) and DDK (cat# TA50011-5) from Thermo Scientific (Rockford, IL USA) and OriGene Technologies
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products