OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TMEM167A (NM_174909) Human Untagged Clone

Be the first to review this product
SKU
SC101293
TMEM167A (untagged)-Human transmembrane protein 167A (TMEM167A)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TMEM167A or NM_174909"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TMEM167A
Synonyms TMEM167
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC101293 sequence for NM_174909 edited (data generated by NextGen Sequencing)
ATGTCTGCCATTTTCAATTTTCAGAGTCTATTGACTGTAATCTTGCTGCTTATATGTACC
TGTGCTTATATTCGATCCTTGGCACCCAGCCTCCTGGACAGAAATAAAACTGGATTGTTG
GGTATATTTTGGAAGTGTGCCAGAATTGGTGAACGGAAGAGTCCTTATGTTGCAGTATGC
TGTATAGTAATGGCCTTCAGCATCCTCTTCATACAGTAG

Clone variation with respect to NM_174909.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_174909 unedited
GCTGCGGCATCGCCGGCCTCGCTATGTCTGCCATTTTCAATTTTCAGAGTCTATTGACTG
TAATCTTGCTGCTTATATGTACCTGTGCTTATATTCGATCCTTGGCACCCAGCCTCCTGG
ACAGAAATAAAACTGGATTGTTGGGTATATTTTGGAAGTGTGCCAGAATTGGTGAACGGA
AGAGTCCTTATGTTGCAGTATGCTGTATAGTAATGGCCTTCAGCATCCTCTTCATACAGT
AGCTGGGGAAAATGCCAGAATGTAGTTGCCATCAGATTTGATTGTGAACAAGGACTGACT
GCAGAAAATAATGGAAAGGATGTTTAACTCTTTTATCTCCGAACATTGAATGAGATAAAT
TTCCAGATGCTGTTCTCTATTTTAATGTTATTGGACCAATGTTCTGTATAAACAATTAAG
ATGTAACCATTTAATAGTCTGTAACAATCAACCTCAGTACTGTCACTACAATATTACATT
CTGCAAATGTNATTCTGTTGTATCAGATACAAAATTTTAGTGAGGTATCTCTAANGCACA
TAGTAGAAAACAAAATTGGTTAATTACTCAAGTTCCTTTCACTGNGATTTGGAAATGATT
TAATCTTTATAGAATGAAAACCTTTTTTNGGACTAACCTTTTTTATTAAAATGGCTCAAT
TTTGNGTTGATAAGGATTGCATTAATATTTNAATAGGGGCTTGCTTTTTCCTCTGGGCCC
ACCATTTTGGATCATTAANCAAAANACCTCTACTCNTAACNAACTCTANTTTATGACAAG
NNTTAAAAAATTTTAAAACAAGCTTATGCAG
Restriction Sites NotI-NotI |
ACCN NM_174909
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_174909.1, NP_777569.1
RefSeq Size 726 bp
RefSeq ORF 219 bp
Locus ID 153339
UniProt ID Q8TBQ9
Cytogenetics 5q14.2
Protein Families Transmembrane
Summary Involved in the early part of the secretory pathway.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_174909" in other vectors (5)
SKU Description Size Price
RC210448 TMEM167A (Myc-DDK-tagged)-Human transmembrane protein 167A (TMEM167A) 10 ug
$150.00
RC210448L3 Lenti ORF clone of Human transmembrane protein 167A (TMEM167A), Myc-DDK-tagged 10 ug
$450.00
RC210448L4 Lenti ORF clone of Human transmembrane protein 167A (TMEM167A), mGFP tagged 10 ug
$450.00
RG210448 TMEM167A (tGFP-tagged) - Human transmembrane protein 167A (TMEM167A) 10 ug
$489.00
SC321043 TMEM167A (untagged)-Human transmembrane protein 167A (TMEM167A) 10 ug
$150.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products