MRP5 (ABCC5) Human Gene Knockout Kit (CRISPR)

SKU
KN217669
ABCC5 - human gene knockout kit via CRISPR, HDR mediated
$1,657.00
4 Weeks*
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol MRP5
Locus ID 10057
Components

KN217669G1, MRP5 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTCCTGGGTATAGAAGTGTG

KN217669G2, MRP5 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCTTAGGAAAGGAAACTGAC

KN217669D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001023587, NM_001320032, NM_005688, NR_135125
UniProt ID O15440
Synonyms ABC33; EST277145; MOAT-C; MOATC; MRP5; pABC11; SMRP
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that this protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. This protein may be involved in resistance to thiopurines in acute lymphoblastic leukemia and antiretroviral nucleoside analogs in HIV-infected patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Shipping Ambient

More linear donor DNA can be ordered separately

Cat# KN217669D
Description 10 ug linear donor DNA for KN217669 kit
Price $515/€515
If you want to order 20ug, please order quantity of 2 for KN217669D
If you want to order 50ug, please order quantity of 5 for KN217669D

Other selection marker is available for donor DNA.
Please contact techsupport@origene.com for a custom quote.

different donor dna img
Write Your Own Review
You're reviewing:MRP5 (ABCC5) Human Gene Knockout Kit (CRISPR)
Your Rating
SKU Description Size Price
GA106814 ABCC5 CRISPRa kit - CRISPR gene activation of human ATP binding cassette subfamily C member 5 1 kit
$1,657.00
KN217669BN ABCC5 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217669LP ABCC5 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217669RB ABCC5 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN417669 ABCC5 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.