Human c-Myc (MYC) activation kit by CRISPRa

SKU
GA103055
MYC CRISPRa kit - CRISPR gene activation of human MYC proto-oncogene, bHLH transcription factor
$1,657.00
2 Weeks*
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol MYC
Locus ID 4609
Components

GA103055G1, c-Myc gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTATGTATGCACAGCTATC

GA103055G2, c-Myc gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCTTTGGCAGCAAATTG

GA103055G3, c-Myc gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAATTGGGGGACTCAGTCT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_002467, NM_001354870
UniProt ID P01106
Synonyms bHLHe39; c-Myc; MRTL; MYCC
Summary This gene is a proto-oncogene and encodes a nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. The encoded protein forms a heterodimer with the related transcription factor MAX. This complex binds to the E box DNA consensus sequence and regulates the transcription of specific target genes. Amplification of this gene is frequently observed in numerous human cancers. Translocations involving this gene are associated with Burkitt lymphoma and multiple myeloma in human patients. There is evidence to show that translation initiates both from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site, resulting in the production of two isoforms with distinct N-termini. [provided by RefSeq, Aug 2017]
Write Your Own Review
You're reviewing:Human c-Myc (MYC) activation kit by CRISPRa
Your Rating
SKU Description Size Price
KN201611 MYC - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201611BN MYC - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201611LP MYC - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN201611RB MYC - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN401611 MYC - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.